Description :
From Genome Similarity Track
Location :
Scaffold_57:51896- 55338
Transcript NameFunction/comments
Physo_137743reverse transcriptase
Physo_137744hypothetical protein

Sequence
3442 bases(100 bases per row)
CGATACCGGCGTAGACGCCGATACCTCGAAAAGATGTAATCATCGATTCAATGGCCAGGAGCACTATCTACAGTGCTCGTGATCTGCGCGATGCGTTCTA
TCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGTCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAAC
GCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGACTG
CGGACGGGATGGGCGATGTTGAGATGCACCTTGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCCATGCAAACCTGAAGAAGTGCAT
CTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTCGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACG
CCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTCTAAGTTACGCGGACATGATACGTCCGCTGTCCCAGCTCCTGAAGAAG
GACGCCGAGTGGGTTTCGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGTCGACCAAGATC
GCCCATTCCACGTTGTGTGTGACGCACCCGACTTCACAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTCTACTACCAATCGCGTCAGCTGA
AGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACTCTT
CGTGGTCTATACGGACCACGCGTCGCTGCGGACGGCTGTGAGGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAAC
TTCCGGGTTGAGTACAAACCCGGAAGATTCAATGTGGTGGCCAACGCGCTCTTGTGTCGACCGGACTACGCCACGACAGATGCCGACGTCAATGCTATTG
ACGCCATGCGATCGAGCACCCCGGCGCCGTCACTGTTGGACGACGTGAAGGTCGCGTTCGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTC
AACGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTC
GACGACAACGCGGACCGCGTTGTCTCGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCC
GTGAGAAGACATACCTTCTTCTCACGCGCGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGT
GAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCATTACCAACTCCACGGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCG
GACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAAATGATACATCTTGTTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGG
CACGTCTGTTCGTTGACAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCATGCACACCTTTGACAAGAAGTGTTTACACTT
CTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGGCGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGGGCTTAAGAGCTACG
CTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCAGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAA
TGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGACGGTGGCTCATTCCTTGAGTGGGGGAGGATCTACGACTACAACGCAGCAGCCGCAGTATGCC
GCTGACACTTGCACAGTGTCAGTCGCGACTACGCGCAAAAAGAAGAAGAAACACGCGTCTGTGCAGGCCACAGACGCCGACAAGAGCAAGGAGAAAAAGC
AGAATGGGTCTGTGCAGGGCACAGACACCGCGAAGACAAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAA
CTTCGCGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTCGACCGACAGAAGCTGAACCAGACAATGTTGGTAGGGGCA
ACACTAATGAATTGAAGAAGGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAACAAGCTCGCTCCACG
CTTCATCGGGCCGTTCACGGTGTTGACACGGCATGGCAACGCCTACACGCTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGCGG
CTGAAACCATATCGGCAGTACGAGCCACCCAGCTCGGCTGGCCCGAAGCGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTGGGC
CAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGTCTAAGCAACTTGAGCCCTCAAGATCGCCACCTCCTGCTTCAGA
GCGGCAAACTCCCGGCTCTGAAGCTGTTCCACAGCAGCGACCCGCTCCTCGAGCGTTCGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTC
CCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTCGATTGTTGAGCGTATTCTGAACCATAGTATCCCGAAAACGAACCGGCAGCCGG
TTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAAATACATGGGAGCCACGGGACGTCCTGCTGCAGGACGTCCCGGAAATGGTGAGGGCGTA
CGAAGTTCTCCATGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGTTCCTCGCGTGCCAAGA
ACTTGGCACGAAGATCCTTGAGACTCTCAGGTACACGAATCGTCGTGTAGCCGTTTAGGTCGCGGTCGCTGAAGCGCGCCGCACCCGGAATACACAACGT
GCACTGATGGCCTTCAGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGGGGAGCTGCTCCAGCCTCCCGCGCGTCGAGAATGTCTCGAAGCGC
TCACGGGCATGCTTAACCCGCTCACGGTAAGCAACCGGCTTC