Description :
From Genome Similarity Track
Location :
contig_76:51891- 54644
Transcript NameFunction/comments
g10061.t1mannitol dehydrogenase, putative

Sequence
2753 bases(100 bases per row)
AGACGCGTACCACCGATCCAGCCGTGCTGAGGCCATGTCCCCAAACATCAGTCGATATGAGTAGGTGTGGGTTCTCTCCTGATATGCTGCGATAGTATGT
TGTTCCGGCCCCGTTGGGGGCTCCAGCGCGTCAATCAGCCCCCATTTTGTCATGAGCGCCTCCAGTGCCCAGGAACCATGATCCGAGTGCGGACGGAAAT
GACTTCGGTCCACGCGGGGATCAAGCGTACAGTTAAAAAAAACGACAACCACCCGGTCCAGCGATGGCAGTTCCATCTCCCCGAGCATCCCATAGAAATC
CTTTCTCGGGCCTTTTCGGTGGGGTATGTAAATCCAAACGAGCAGCATCTCCATGCCGTCAAACTTCCCACTCACTGCCATGAAATGAGGAGACCACCTC
TTCGGCTTGACCGATGTCGCCTCTTTGAGAAGTCCGTATGGATCCACCAAAATGGCCACGCCGCCCTTCTTCTCTTCCGACGGTGCCCAAAAGCAGAGCG
GTGGGCATCCGCCCCCACCCTAAAGCCCCACGTCGAAGCATGTAGTCGCGTAAAATATTCCACGTTGCCCTGCTCAACATGTGTCTCCTGCAATAAAACA
ACGTCATATCTGCCATGGCCGTCCGATTTCTTCCAGGCGCGCATCCATTCGTCCCAGTAAGCGTCATCGGCCCCAAACCCATTCACATTTTGCGAGAGGC
AGCTGTAGGTGCGTTCATCAGGGTGCAAGTGCCGCCTCCTCTGCTCCGGCTGTTGATCCGCTATCGCTTCCGCCCGCTTGTGCCGCTTTGCCGCAATTCG
TTTGGCAGCTGTGAAAACTCCTAGTACCTGGTGTTTACGCTCGTCCGCTGCAATATGCGAGAATAAATCGCCTAGAAGGGGGGTATTGCCGACACGCCCG
CCGCGTGGAGAGCCTCGCTGCCCCCCCCCCCCCCCCCCTGGTTTGGTCCATCCGGAGTGTAATTCGAAATTCGAATGGTCCACGTTAGAGGCCTGGCGGC
CCCACCTCCATTGAGATGAGTCTGTCGTCCCACGTGAGCCCGCTCGGTATCATTACCGCCGCTCCCCATCCCGCTCGTTCATCCACCATTTCACACAGTG
CTCGAATCGCCGGATGATTGTAATACTGATGCCCGAGCTGACTCCTTGGGACTCGACCCATGGCCGTCGCTGGCCACGCCCACAGAGTGTGCGGCAGTGT
GTGGAGAATGTTCCAGCAGGATTTCGTCATGGATTCCGGTCTCACACAGATAGGTGCGCGAGGGCATAGTTGTCGATGTTTCCCCACCGATGACGATCGC
TGCCCACATATATGTCTTGCTCGTCCCCGTCGTGTAATGTGCAAGCTGCCAACCAACTGCGGCAGTGCTCAGCAGATTCAGCGCTCGAGGACGTGTCTCG
CATGACAGCTCTGATCGCCGCCACCATGACGTCTTACGCCTCCAGTGCTCCCCATTGTTGCAGTACTTTTGCCGGCAGTTGCTTGCCGCCAATTATAGAT
ATGGTCGGTACTCAAAAAGGCTCCTGAGCTCCACGCGATGCGATAGCAACCACGGCATCATGTCCACAAGCCCACGGCTGTCATCCTTAGCTTTGGTCAG
CTCTTTTGACTGGGGGAAGATCGACTCCACACCGCTGTCGCATCCGCATTCACCTGCATTAATTGTCGGGATTTCGTGCCATCTGGAAGGAGTTCAGGCT
CTAGCCCTATCGAATCCAAGATCTGTTGTAAGGGAGCCACCACGACCCTGCCATGCGACGTAATTGGAAAACGCGCCGATGCTCCGCCACATTCGGGTGT
CAGCTCCCTGGGCTAGTCCTGGTGCTGTGTCACCATCGGGACCAGCCGCAAGCCGCAGCCTTTCCCCTCTCCAACGAGTGTATCCTCCATTCTCGCTATA
TCGTAGCCAACGCTGTTAGCCTCGGGAGTCCAAGCCGGTAATGTAGCACATCCAGTCGGTTCCTGTGTTCGATCCCTCCAATGAGAATCATATCATTCTC
TTACGTGATCATCTTCGGGTCCACCGCGTGGATCCGACCAGCGCTGTAATCGATGTGGGCGACGACGTTCGCATGCCAGGCGTGGCTGGAGCAGTTGGCG
TCCGCAAACTCTCGGTCCTCTTCCGCCAGCCACCTAGTCGATATCTCCCTGTGATGTACGCCATAGAAATGGCCCTCATGCCGTTTGATTACTAGCATGA
CCGGTAGGATATGTAGTCTCGTGTAGTGCTTCAGCATGTCCTTGGCCGTCAAATCATACATGACACCTCCACAGCCCGATTCATGGTCACCTCCGTAGGC
CAGCGAGTAGTTCTTATAGTAGTAGCGTTGGACATGGGCGTCGTTCTTGGCATCCCACATCAAATACGAATAGCGGCTCACGGAGATACTGGGCCATGGC
CCTCAGCACTTCTGTCCCCGCCCAGAACTCGGAGGGGATATGGGTATTAACCGACCGAGCCGTTCCTGGCGTAATGGGCAAACAGCGATGTCGTTGCCGC
GACCTGATCCGATGACGGCGGGTGCTCGGGATACAGTCGTGCGAGCTTCCTCGTCGGGTCGACGATTCCGCACTCCACATCACGCGCCAAGTTCGTCATC
ATCAAAGTGTAGATACTTCGCTTGATGGCGTTGGTGTGGCGTACTGCTTCACTCGTGAATGAGAGAGAGAGAGCCGCCATCCACGTAGGGGTGGCATACA
GCGGCGCATAGTCACATTGCCCATTGGCCGGCACTGTCACCAGCGATTTGTTG