Description :
From Genome Similarity Track
Location :
Scaffold_21:51890- 52952
Transcript NameFunction/comments
Phyra_71460ATP-dependent RNA helicase eIF4A, putative

Sequence
1062 bases(100 bases per row)
CATTGAGACCTTCGACGGTATGGAGCTGCGCGAGGACCTGCTGCGCGGCATCTACGCCTACGGTTTTGAGAAGCCGTCGGCCATCCAGCAGCGCGCCGTC
AAGCCCATCCTGCTGGGCCACGATTGCATCGCCCAGGCCCAGTCCGGTACCGGTAAAACCGCCACGTTTGCCGTGTCCATTCTGCAGAAGATCGACATCA
ACCTGAAGGAGACGCAGGCCCTGATCCTCGCCCCCACGCGCGAACTCGCCCAGCAGATCGTCAAGGTCGTCGTGGCCATTGGCGACTACATGAGCGTGCA
GGTGCACGCCTGCGTCGGCGGTACCGCCGTGCGCGACGACATCCGCACCCTGCAGCAGGGTGTGCACATCGTGGTGGGCACCCCCGGCCGCGTGGGCGAC
ATGATCAACCGTCGCGCCCTGCGCACCGACGAGGTCAAGATGTTCGTGCTGGATGAGGCTGATGAGATGCTGTCCCGCGGTTTCAAGGACCAGATCTACG
AGGTCTTCCGCTTCCTGCCCGAGAAGGTGCAGGTGGCTCTGTTCTCGGCTACCATGCCGCTGGACGTGCTGGAAGTGACCCACCGCTTCATGCGCGAGCC
CATCCGCATCCTTGTGAAGCGCGACGAGCTGACCCTTGAAGGTATCAAGCAGTTTTTCATCGCCATCGACCGCGAGGAGTGGAAGTTCGACACGCTCTGC
GATCTGTACGAGACGCTGACCATCACACAGGCCATCATCTACTGCAACACGCGCCGAAAAGTGGACTGGCTCACGGAGAAGATGCAGTCGAAGGACTTCA
CGGTCTCGGCCATGCACGGCGACATGGAGCAGCGTGAGCGCGACATCATTATGCGTGAGTTCCGTTCGGGCTCGTCGCGTGTGCTGATCACCACGGACCT
GCTGGCTCGTGGTATCGACGTGCAGCAGGTGTCGCTGGTCATCAACTACGACCTGCCCACGAACCGCGAGAACTACATCCACCGTATCGGTCGTTCGGGC
CGTTTCGGCCGTAAGGGTGTGGCCATCAACTTTTTGACGCACAACGACGTGCGATACCTGCG