Description :
From Genome Similarity Track
Location :
Scaffold_1816:5189- 6246
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1816-snap-gene-0.0Gene of unknown function

Sequence
1057 bases(100 bases per row)
CGTATACCGTGTACCCACTGTAGCGCGACTAGTTATCGCGACCGCAACTGCTGGAACCGCCTCACGTGCACCGCATGTGACGTCAAGGGACACCCGGCTG
AGCATTGCTACCAGCGGTGCAAAGGCTGTGCGATGGTTCATGAGCGCGGAGAGTGCGAACTCGCTCAGCTCGCCGACCAGATGAAGGCCTGGTTCGACCC
GTCGAATCATGCCGGACTTCTGCCGCCGCCGGTCGAGAAGTGGTTAAACTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTCACGCGACGGGCGAT
TTGCCGAAAGGACCGCGTGCGTCTATGCGTACATGGGTAGGCCGAACTGCGAAGTGGGGTCTATTCATAATACACGTACTGTTAGCATGGCCGGACCACA
AGTGAACGAGTTTGAACGTACCAGGGTCGTGCAGCGCCTAGTCCTCAGGATTGGCGAGCGGCGCGGCTTCTGGAAGCACTATCTGCAGAAGGAGTATCGC
CAGACCATCGTTCCCGCACTGATCGACGACTGCTATGCCCGAGTCCTGATGGATTCTGGCGCCGAAGTGTCAATACTTGATTTCGACTTTGCGCGTAAGA
TCGGAGTCTTCGTCGACACTTCGGAGCGGCTGGAGTGTGCTGGAGTCGGTGGTGCTGCCTGTCCGACTGAAGGTCGTGCGAAGGTCAAGATCACGCTGGG
TGGTGAGCTGGCGTACGAGTTTGCTGTTTGGGTCGGAAGGTTGGGAAGTCCTCAAGCCATCTTGGGTACCGACTTCATGGAACCAGCTGGAGTCCGGCTC
GACTTAGTCGAAGGCGTCGCACGGCCCCCCGAAGAGGTCAGGATTCGCTTCGAGGGGCGTAAGCCGCTGTACAGCGATAAAGCCGAGAAGGTGCGGGTGA
AGAGCGAGCTGACGCTGCTGAGTGGTCAGTCGGTGCTGCTGAAGGTGAGACTATGTGCAAGGAAGAGGCTGTGGGTCGTCCGGGGAGACCACTGGGTGAC
CACCGCGGTCCTCGGGGCTCGAGGTGAAATAAAGCATCTGAAGATCACGAACATCGG