Description :
From Genome Similarity Track
Location :
Scaffold_28:51887- 52888
Transcript NameFunction/comments
Sapdi_VS20SDRG_08895hypothetical protein
Sapdi_VS20SDRG_08896hypothetical protein

Sequence
1001 bases(100 bases per row)
GTCCGTCACGGACAAGAAGTTTATGCAGAGAGTCGCCACGACCGTACGCCCGCTTTATCTGCTGCGTCGACGAAGACCTTATGCTGCGTAGGCGCTGGAC
CACACGGTGCGTTGCTGCGACCCGCTCGACGTGCTCTCGGAGCTCTTGCCGTTCGCGACCGACAAGAACGCCCAGCTCGTGACCAAAGTACTGCTTGTTT
CAAAGTATCGAAGTATCAATCGGGAAGTGTAGGCTGGGACCTACGTCGAACAGTGCCTGCTCAAGAGCCTCGCGCAGCCATGGGAAGCCGCGCAGCTGCA
CGCATGGATCACACCGCTCGCCAACTTTCTCAACTGCCGCGACGTCCACGGCAAACCCGCGGCGAAGCGCTGCCTCATGCTCCTCCGCAAGACGTTTGGG
GTCCGTTCGCGTCCAAGTCCTCCGTTTTGTATGTAGCGCTGTGTAGGATGTGGCATTTGAAGCCGCTGTCGACGCGCAGCTCAGTGGCATCACTCGTGCC
GATGTTCTCAAGGTCTCGACGGCCGCCGCCCGAAGCTCGAGTATCGTACGGGTGCACCCGGGCCAAAAGAAGGGCGCCAAACTCAGCACGCGGTCGGGCC
CGAGTCTCAAGGAGCGCCTGCAACAACAGCAACAGGCAGCAAAAGCGACGCCAGTACCTAAGTCGCCGTAACGACACGAGCTCAAACACATTGCGTTGGC
TTGCATTAGTGCGGCACAAAGGCGCTCGGGTCGATCGCAGCGATCGCGAGTGCATGCGCCGGCACACGGACGACCTCGACGCTGACCCCGGCGCCATTGG
ACGTTTGCAGCTCGAGCGATGGACCGTAAAACGAGCCAAGAGACAGCTGCAAGACTAGCGCGTTGAACGACGACGAGAGCACGATAGCCGATGCAGTGGC
GAGCCCGGCAAGGAGGCCTGGTAGCTGCGCGGGGGCGGCCGACGCCGGCGCAATCGTTCCGACGGGCAAGCCGCCCACGAAGACGGACAACGAGACGTTG
T