Description :
From Genome Similarity Track
Location :
Scaffold_119:5188- 6930
Transcript NameFunction/comments
g9499.t1hypothetical protein

Sequence
1742 bases(100 bases per row)
TTCTTTACCGACGTCCAGTGTGGAATTTGAACAGGACCCACGCGAAGATGATCTCGAAAGCCACCGCGTTGGATCCTAGGATGGCCAGATCACGTCCCAG
ATGGACATTCTCCATACCGAACCTGTCCAGGATGTACTGGGCTGCGGGGTCGCTGTCGGTGTGGAATTGATTGTGCATAAGTGCCTCAAAGCCGTAGGAC
AGGAACCCGAGGTAGTGAGCCCAGATCCAGTAGCCCGGAATCGCAGGTCGCGGCACGAAGAGCCCCATGCACAGGATGAACCAGCCGAAGATGGCAGCAC
CCAACGCCATGCCGATGATAAAGTGCGCCACGCACGCAGCAACGAGGTGCATCAAACTCTCAGCGACCACCAGGGACAGGAAGATCGTCAGCAGGAAGAC
GCCGTACGAATTGAGGTCCGCTAGGTACCCTACCAGGAGCGTCGACGTGAGCGCGATGAGGAAGATGCCAGGCAACGCACCCAAGAAGTTGGCGATCACG
TAGCTGAAGACGTTGAGGTTACTGTTTGTCCGTTCGCGGAGGAAGACGGCGCGCTGTTCGATGAAGAACGGCAGCACGGCGATGGACATGAACACCAAGA
AGCAGTTGGCGTACGTGAGGAGATACACCTGGTCGTGAGCCGTGATGCCGTCGTTTGTAGACAGGAACATCGTCCCCATCATTGCCGAAAGCGCCGTGTA
CATGACAAGTCGAACCCAAAAAATGCCGGGGTTGCGGAGGTTGTCGAGCGAGTTTCTCTTCAGCAGCACAACGAGTTGTCGAAGTGGCGAGTTTGGGACG
CGTTCAGTCGCTCTTGCTGCAGGTAGACTGGTGGAATCCGTTTGGATGGCCTCTTGGATACGAGCAGCTACGGGGCTGGCTGCATATCCTGACACCAGCA
GTGAAATGTCCCCATGGCCTTCGAAGTCGGTGTTTGCAATGCTGATATAATGCTCTGCGGGGTCTTCGTGCTCAGGGCACACGTAGCCTAGTGACGCGAA
ATGCGGCAACATGTCCACGCGAGGCCCGAAGTAGACCGTTTGGCCTGCAGTCAAGATGACCACATTCGTGAACATGTCGTAGACCAGGGACGAAGGCTGG
TGGATGGTACATATCACGGTCATATTCTCCTTGCAGAGCCGCGTGACAAACTTCATGACGTTGTATGTCGAGGCCGAGTCCAAGCCCGACGTTGGCTCAT
CAAGTAGCAGTATCGATGGCTCCGACAGCAGCTCAATGGCGATACTCAGTCGCCGCTTCTGGCCGCCCGAGATCCCCTTCCTGAACATGTCCCCGACTAG
GGCGTGCTCACACACTCGCAGTCCCATCTCGTCGATGACATTCTGCACGCGCTCAATCACCTCGCGGTGAGAGATGGAGCTCGGCAAACTGAGGTTCGCT
GCCATCTCCAGCGTCTCCAGAACCGTAAAAGACCCCAACAGGGAATCTTCTTGGGCTACGTAGCTCGAGACTGCTCGGAACGTCTTGATGTCGCGGGCCG
CTCCGTTTAAGGCGATGTCCCCTTGAATTGTACCCGAGCCGATTCGGTCAGCGAGGATATCCAGCAGTGTGGTCTTGCCCGAGCCGGACGGTCCCATGAC
GGCCGTGAGCTCTCCAGGAGCACATCGTCCAGTGACGTTGGTGAGGATGGTCTTCTTGCCGTCGGGGTGCGTCGGCGTTTTCTTCTTCGTGTTCACCGTG
TAGCAGAGATTGGACCAGCTCAATGTGAACGGGTTCGACGTC