Description :
From Genome Similarity Track
Location :
Scaffold_76:51878- 53360
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014832Similar to pol: Retrovirus-related Pol polyprotein from transposon opus (Drosophila melanogaster)
Pytul_DAOMBR144PYU1_G014831Similar to Tf2-1: Retrotransposable element Tf2 155 kDa protein type 1 (Schizosaccharomyces pombe)

Sequence
1482 bases(100 bases per row)
CTGGCGTTACCGGACCACACAAAAACTTTCAGTGTCGTGTGCGATGCCAGCGATTTTGCAATCGGCTGTGCGCTGGTGCAGAAGGATGATGGCGGCCATG
AGCGCGTCGCATCATACCAAAGCAGACTGCTTGAGGCAGCTGAAAAGAACTATCCTGTGAACGACAAAGAGCTACTTGCGATCAAGTACGCTCTCTTGAA
GTTCAGGGTCCGCCTTTTGGGTGAGACACCGTTCATTGTGTACACGGATCACGCGTCCTTGCGGATCGCGATTAACTCTTCCCATTTATCGCAGCAAATG
GCGCGATGGCTTGCATTCTTCTCCGAGTTCAACTTTCGGGTCGAATGCAAGCCGGGAAAGGAAAACGCTCTGGCGGACGCGCTTTCGCGCCGTCCAGATT
ATGAGTCGAGCGTTGACAACAGCTCCGACGCTCTGTGCTTGGAGCGCACTCCTGATCTCATGCATCTGAGCATCAGTCGAGTACAAACAAAGCTCAAGGA
CAATATTCAGTCGCTTTACTCAAAGGACGATGAATGTCGCTTGTTGATAGCTCGCTTTGACGGCTCGTTGAAAGAGTCATTGCCTGCCAAACTCGAGTCA
AAGCTTGCTCGGTTTAGCTATCACGACGGGTTGTGGCATCGACTGTCCAACTTCGATTACTCGCGTGTATATGTACCGCATGACCAGGATCTGAAACTTT
CGATCCTTCACGAGTTTCACGATGCACCAGCGAGTGATCATCTCGGGCGTGAAAAGACCTTCTTTGCAAGTGTCTAATGTGTTTTGGTGGCCACACCAAT
ACAAATGGGTGACAAATTATGTACGCTCATGCGAGCAGTGCCAGAGCGTGAAGCCTGCGGGAAAGAACAAAGCGCCGCTACATCCGCTGTCAATTCCGCA
AGATTGCTGGAAGTCGGTCAGCATGGATTTCGTCTTTGGTTTCCCAGAAGACAAGGCGCGCAACACAGGCGTCGTCGTGTGTTGTCGACCGACTGAGCAA
AATGGTGCATGTTGCACCTGTGCGCAAGCATGTCGCTGCCCAAGAGACGGCGTGCCTATTTTTAGAGCACGTGTTCCGCTATCACGGCTTGCCCGAGTCT
ATTGTTTCAGACCGGGACCCGCGTTTCACCGCTGCCTTTTGGTACAAACTCTTTCGCCTGCTCGGCACAGATCTGGCGTTGTCCACTGCCGATCACCCCG
AGACAGACGAGCAAACCGAGCGCGTAAACCGTGTCGTCGAGGATATTCTTCGCAGCATCGCTGTCGATCATCCACGCGACTGGAGCCGCTGGCTGCCGTA
CGCCGAGTTTGCTATAAATAGCAGCGAGCACGCCTCTACGGCCGTGACTCCGTTCTATTTCAACTCGCTGCGGCACCCGCGCGTACCCGCCACTCTGTTT
GAGGGCATCGAACGTTCTGCGGCGGGAGGGCAACTCGATGCGAGCGCGCGATCTCCGTCACCAGACGTGGCGCCGACCACTC