Description :
From Genome Similarity Track
Location :
Scaffold_142:51876- 53783
Sequence
1907 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCGCTGGATTATTCAGCGGAATTTGCCCATCACAGAAGTAGAGAACAA
GCTGACTCGTGAGGTCGTGACTATGACGCCTACAACAGTGAGGACGATGAAAACATACATGCGTTTTACCGCAACTCTTCTCGGTTGCATTGAGGATGAC
GAGGAAGGGCATCTTTAGAGTTTTGTATTTGGCCAATACATTGAAATGATTGCAGTAACTATTATTGTGTCCTTGTGTATTGCAGTAATTATTATGGACC
TCTAGAACAAGCAGTAACATTGATAAATGTATTTGCTGGGCCCTGCGGGACAGCAAGACAGTCAATTGTTGCAATATCTACAAGCTCAAAGGTGGAGATT
GTCGAAAGCAGCATATGCACTGTTCCTCAACGCTGCCGTTGGCCCGAGCGCGCATTTTTGTTCTTATGATTGCTGCCATCCCAAGCGTAATTGGGACCTT
CTAAAAAAAAAAAACAGCCCCGAGTAGTGAACATACTGCTTCGGAGGATCTCAAGTACTAATTGGAGCAAGCGAGTGGCCGTTTCCCCCTATACGGGAAG
AAATTGCAGGTCCTCCGGACAAAACCAGCATGTTACGTGCTTTGTCGGCCTTCTAAAGGGTAGGATAGGAGAAGTATTTAATGGGTGTCGAATTGACAAC
TAAGGTAGTAGAAAAATGTGACTGTAGTCATCCTACTATGGTGTCGATTTGGCGTGAAGAAGGAATGATCATCGGAGGGACAGATTAGTTATCACTTGGG
TTTCGCATTGACACAATTCAAATGGAAGGTCATAGAGTTTATGGCAGGCCTCATAATTCTGTAGATTTCTACAAACTTACAAAACTAAGCTACTTTGTAG
ACACCAC