Description :
From Genome Similarity Track
Location :
Scaffold_23:5186- 8629
Transcript NameFunction/comments
Phyta_totarag1275hypothetical protein PHYSODRAFT_495649
Phyta_totarag1276conserved hypothetical protein

Sequence
3443 bases(100 bases per row)
GCCCGATCCTACGTTTTCGCCACGCACTGACAGTCCAGGCCGATCCAGCGGCACAGGACGCCGTTTTTGCGGCCAACATCTTCAAACGGCTGGAAAACGT
GTCAATTGAGCAGCATCACGTGTTGCGTGTTACTCTGGATAATCTACTGAAGAATTCTTCCGAGGTAGCGCGACTGTTGTGTACGTGTGATCCGATGGAG
CTACGCAACTCGTTAGTTATCTACGAGGCGTtgcgagaagcagcgaagCGCGGTGTCAAACATCTCGTAactggagatgctgctgacGAGGTGTTCTGCG
GCTACTCCTTCTACCACGGGATGACCGAGGAGGCTTTAAGCAAGTATCGCGAGCGAATCACCGCCACCATGCAGTTCACTACGGCCAAGCTCGCGAGAGA
ACTTGGAATTGAGGTCATTAGTCCGTTTCTCGATGCTCGCGTCGTGGCTTTCTCCAAAACGCTCAGTAAAAGCGACATGGTAGGGGAACGTACTCCAGTG
CCTCGTGACGGCGCACAAGGTGTACATGGCAAGTTGATCCTGCGCCAGGCGTTCCCTGAGAGTTTCTCGCAGTGGCGAGCTAAGGAGCCCATCGAGTCTG
GATCTGGCACCACGCGACTGCGTCTCGGGTACTTCGATTCGCATTGGACGGAAAAAGAGTttgccgagcagcagcgtgttaTCTTCCGAGGGCACCGCGT
GTATATCCGCGACCGAGAACACGTGTATTTCTTCCAGGCTTTCTTGCATGCCTTCGTTGGAGACCTGATGAACGTACCGCGACAGAGATTTAATGAATCC
TCTCACATGGTGGAAACCCACGGACAAGAGGAGACTGCGGACATTCCGAACGTGTTTTGCCCTGGATGCGGCTTTGAGCTCTCGCACCCGAAACAGGATT
TCTGCGTGActtgtggctgctggccGACGTGCATCTCGCCAACCAACGACACGCAGGGCTACGCAACTCAAGCTCTTGCCAAGCTCAAGAGTGAGAAGCA
GCGTCTACTGCAGCATTAGCGGTAAACGACGTGGAAAGCCAATTGAAAGATCCAAGTatggactgcagcagcattgttCAGTGATGAGGACAGCATTAAC
GAGACCAAGTTGTGACCAGGCTAGTTGGGTGCTTTACTAGTTCGTTCAACTGATTTTTTGCTGGTTAATATGAACATCTCCACCGTTGGCACTAGCATGA
ATTTAGTTCCTATCAATGTCATACCACGCCGGGAGGTCTCTCTTCATTTCCGAACTTCCTCCCCAACTTCACTTGCTCTAAAATGCAGTCGTGGGTCGTT
TCTGCCGTTCTGTTTGCATTTGTGTTGAGTGACTACTGCACGACCGCACAGAACGATGGGGTGTTGATCTTCTGGGGCGACAAGAACTTCAAGGGCGAGA
AATGGGACTTCCACCGTTCGCTTGACGCTCAGTACTGCTACAACGACAACGTGGGGAAGCCGTCATCGATCACGTGGAAGCGCCAGCTGCAGACTGGCAA
ATTCGacggcaaggccaagatcgcCTTCTACACAAAACACGACTGCAAGGGCACGTGTCGTTCCTGGCTTACTACGGAAAAGGACTTCCCCACGAATCTG
GCGCTGGACGGCATCGacaacaagatcaagtcGTTCATGATTTGGCAAACCAGTAAAGACGCTGAAATTCGCGTCCATGACGCCCGGGCTCTGCGTCGTA
CTGAAGAGTAAGAGGTTTGGTCAGGTCGATCTGACTTCGACTTGCGCGATTTCATTCTACTGTAGCCGTCAATGAACACGTAGTCTTGCAGCACGTTTAC
CCCTCGTCTACAAAATATACGCAATTCAAAGCCATCGTCCATCACGTGAGTCCGACGGCAAATCCAAGGTCACCTTCTACGACTTCGAACTGCGAGGGTT
CAAGGATTGCGCAGCACCCGAGAAGAAAAAATATACATGGTGGGTTTCAGGATTTTTGATACAGATCGCTGTGTTTCACAGAATCCCCACTAATGACACC
AGCATATACTACAGGATCTCTACAGTGAACAAAACTCCTCGCGAGATGTTTTCCTCATTCTTTTTTGCTCAGGCTGCTACAAACGTTACGCTGCATGTAG
ATGACACGTATTGGTTCCATTGCCATGGTTGTATTGATGGCAGTATTGGGTGGAAACCTGTTGCACGAACGCACAGAGTGGCGTACTTGGCGTACGGACA
CTTTGGGATTCCGCGAACTTCACTGGCGAAAAGTTGCAGATCCATCGATCGCCCATCCTGACTATAGGGGGTTGGCAATGCGTGTCGAACTATGCAGTTC
TCAATATAAACGTTGGAGTAGTTTGTACAGATAACAAATGGTTCTCTCCGCTTCGAACGTACTGGAAGGAAAACACCACTCAAGCAGACAACACACCCCT
TGATCATCCTAAAGTGAAGGTTTTCGTGTGCAAAACCTTTCGCAAGTTCTCTGTTTCGTGAGTGTCGTCGAAGTATTCGCTGGAATATATTCCGAGTGTT
CAATGCACAGGCATTATCCCTGCGAAGCCAGCTTCAGCTTACACAAATCtcctgacgcagcagccaaagcTTGCAGGTAGTCAGCACATCTATTCGGATC
CtggttgttgaagttgaacgcTCCTGTTCCCGACTAAGTCGGCCAGTCGGTGGCGCAGATCTACTAGGGACGCGAAGGGGTGCGACGCCTTAGCCGTACA
GTAGCAGTGCTCAAGTCGCCGCTAACGACGCTAAGAGACGACGTTGCAATCATGACGGGCTCCTTGATGACGATGCCCATGCTCATTGTGAACATGGGCG
CCGAGATGATCTACGTGCTGGACCAGCGCCTCAAAGCCCAGAACATCCCTCGAGACAAGAGCTCCAAAGGTATACCCCATTGTGGTCATTGTCGGTGGAC
GTGTCCCCTCTAAACCGTTATCTGTCGTCGACAGTGCTCGAGGACATTGTGAAGACCATGCACAACGAGACGTTCATGACGGAGCTCTTCAAGCCGCACC
GCATGTACTCGAACGTATCCACGCGCCAGATCTTCGACCGTCTCGCGCACTCGTCCATCATGCGTCTCAACGCCAACAGCATGGACAAGGTGGCGTGCTT
ACAGACAGGACTACTACACTTACTCCACAGTTGCTTGAGCGTTGACATTGTGTCGTGTTTCTGCTGTACGTAGCTCTACGATCTCATGCGCATGGGGTTC
AAGTACCAGGTGCTATCGTGCTCGTCGGccgacgagttgctgcaagtgacCATGAACCACCTCGCGAACACCAAAAACCTCGTGGACTCCGTTGAGGTGA
AGCGCCAAGTGGACAAGACCATTCAGCTCACCTCGGAGAACTTCAGTAGCATGAACCCCGCGGACTTCTACATGCTCAAGCAATATCTCTGTCGCTTCTT
CCAGGACACGCGCATCAAAgtgtcgctcttcctccagaaCGGC