Description :
From Genome Similarity Track
Location :
scaffold_881:5185- 8736
Transcript NameFunction/comments
g10527.t1 hypothetical protein PHYSODRAFT_516060

Sequence
3551 bases(100 bases per row)
ACCCGTTACTTCGGCTGAGTGCGCTAAGTGACGAGGGTGGGGAAGGAAATGTCTTCATTGCCAGCGATAATTCCTATTTGCCACCATCCCCTCTGCTGTC
GACTTCAGTGCCGCTTAGAGCAACTCCAGAAAGCATCGACCATATCAATGAAGACGCAGCAACTGCTCACTTCACGGTAGGTGCGCCATTCCTACCCACG
CGTCCTCTGCTGAAGCGGAATGACAGTAAATTTCAAGGAATGAGTTCTCGAACGCTCTGCGATCTCTTCCACCTTGAAAACACGCACGATTCACAGATAT
ATCCGACCACACGTAAGGTTTTCTAATGTCTGAAGCACTTCAAAGATCTACTAACCTTACTTAGAGAAAAAAATACTTGTAGTTTACATTTACACAGGAA
CCTCAAAACTATGGTACAGTAATGTGGTTCGGCCACACTGTGGCCGCTCTCCGCTACCGAGCTTACGCCTCGTGTTTAGCTGTGTAGTTGTAATAAACTT
CATCCTGGTACTCAGGTGCGCAAAATGGAAAGTTGACGTCGCTCTCAGTCGGCGCAAAAAGCTCCTTTCCGGACAGATACGTGACGTAGCAGCCCAAAAC
AAAGCAGACGACGACCACGAGAAGTGCAGGCACTTTTTCGTAGATAGGAACTCGATCCCAGCAGCGTTTCAGGTAAAACACAATTGGCAGGATGATGCAG
CTCATGGTTATCGCTGACGAGCCCACGAAGTCGCTAAGGTCCGCGAAATGATCCTTTAGCAGTACCGACGCAAGAACTTGAAGCGCAACAATGGCAATTC
GCAGCAACACGTACTTGATCGAGTTGGCTCCACGGTATTCAGCGGCTTCGGCTTCTTCGTCCACATCCCTCTCGATATCTGCCATAGAGACAACAGACGC
CATGGATCGCTTCGAACTTCGCTGTCCCTTCATGATAGGAGTCCCAGTGGGGTCGTAGCTAATTGCTGCCTCCACATCATCCCTCGGTAGGTGTTGCTGC
GAGTTGTTCTGGTGCATTCCAAGCACAAGACGTTCGGCGATGTAAAATGCTGGCGATACCACAACAGCAAATGCAATGGTGACATGCAGCTGCATGAAGA
GGTATGCGAGGACGACTGCACCCCAGTTGGAAGCAAAACCGAGCGAGGTCAGTCCCGTGGCAGCGTCTGGGTAGATGGTGAAGAGCAAGTTACCCGATAT
CTGGCACCCCATCGAGGAGTATCCGCTGCTTGCCAGTGCGAGGAAGAGTACCGAGACGACAGTCAGAGTCACGGCAACCACACGGGGCATTCGAGTGGGA
TCACTGTGTTGACGCTGGAGTGACGGGATCACAATTCCGGCGCCGTAGGCGAGTGACAGGTTGCCAAACGCGCTGGCAACTTGCGAGAACGAGATTTGAG
GGGCAGGAACGCTGGGATGGCCACGCATCCCGTGGATGACGACTGCAACGCCAATGCAATCAGCGATAATGGTACCAGCACAACCTGCAAAGGCAGCGCC
AGCTCCTTCCTTGAGCGTCGGGATAAGGCAAACTGGGAGTACCATGAGCGCCATAATTACAATCCAGACTTTTTGGTCGAATGCGTCGGAGAAGAGTCCG
TCGAGTAGCGAACCGCCCAGCACGAGGAATACACAGGGCACGAGTAGACACACACCCATTTGAGAGACGACAACCATGTATCGACCGCCTTTGCCCATGC
ACCATTCGCCAAGGTCACCATACGTGCGTACAGATCTTGGTGCCAGCAGCAGCACCTTTGATATCACCACAGACGCGTACACGTTGGCGAACGCCATGAA
AATTAACGCAAAGATGGCGATCAATGGGCCTGCTCTGGAAAAGTTGCCGGGCATTCCGAGAGTTCCGACGCCGTAGACGCAGCAAAAGAGGTTGAAGGCG
ATTTTTGCGTCCTCCATCGTGAAGAAGGCAGTGCGAGCCATATTGCTACTGTAGTAAGTAGAGCCGAGGGTTGGTAGGTTGGATAATCGTGCTTCGGTAA
CGCAAAAATGAGAATGGTCTTTCGCGTTGGCTGCACGCTCGCGATCTTCTCGTTGCACCACACTGAGACCGAACACTAAGTCATTCGTCGGCGCACACTG
CAAAAAGGTGGCTGACCAAGTGGCTGAAGCAGCCTGTTACTTGTGGCATTTGGCGCGATTGCCAGGCGAGAAACCGTAGGTCTCCGTTTTGGAGCCCACG
TAGATTGATCCAGCCGGATAGCAGCAGCTAATAAAGCTGGCTGAAAACCAGCACCTGGCGTCGAGCATCACAGCAGCACAACCTTGGCAGATACAGAACA
CAGAGCGATTCGGGACTTGGCCGCGGAAGGCTTACCATCGATGAAGGGGCAACGCATCGGCGAAGCTCTAAGTGAAGGCTTCACATGTCAAGTTGAAGCC
CGCTACATTTTAGGGCGTGGCGCATCCTCGGCGGGTTTTTACTCTTGCTTGAAGCAAGTGATCCCATCTTCTGGCCGCCGGCTCTTTTTCGGGGATCGAC
ATAAACCGGTCAGTCTCAGGTAGGAAAGTGAAGAAGACTCCGTATCTCCAGTTGCAATTTCAAGATGGATGCGAATCTTCTCTTTGAAGGCTCTTGTTCA
ACGTGAAATTGCTGTCTACAAATGCGTTGTACATGTATCACCTCGCAGAGGCACACAGCATTTTTAGCGCTGGAAGCACCGGAATGAACAGGCATTTCTG
AAGTTGGCGCATCTCGTTCTGGTGCGTTGGCGTGGGTATGTCTCTAGTCTGGTGCTGAAGCGAACGATGGGCTGGTGTCCATGTATCAGAAGAATCCTTT
TGCGGGGGATGCGCGGCTGTTGCAACTCGAAGATCCGGTTTGTGCTGTGGTGCTGCACTGCAGGTGTTGATGGGCTCTACAGCTGTTCTCTAGGCGGGAA
TGCTCTCTGCAAGTACCAATCGCTGACTGCCACCACGCAGCTTGTCACCACTTGAGCCCGCATTGGTTTCCAATGCTGAATTTGACACTGCATCGAGAGC
TAGGCTAATGTATTGGCAGTGTTGAGTTGCAACATTGTGCTGCACAACCGCCTACCGTAGGCACTGTACTGTAATACAATTCGACGGTCGAATCGACTCG
TTACATGTAACAACTGAACGGCGGAATTTCCGAGTGTATGTCGAAATTTCAGTCTTTTTATCTCTAAAAAAAAAGACATCGAGGAAAAAAAAGACCCCAC
CAGGGTTAACTCGCCTTTTCAAAGCCGCGACGACGATGTCGAAGTTTGAAATTGAAGTTGTGCCTCTCCGTGAGCACAAGTACAGCGCTATTCATTCAGC
CGAGAGCTCATACCGTACATGTACATTTATTTCGCTTGAAAACACGTTCATTACCACCGTTGTGCTCCCGCGACGAATATAACTTGGCGGAGGACTGGCG
GTGATGTGCTCGGCCAGTCGGTACGAGTCCGAAATGGCGAAGGACGTCAAAGTGGTGATTTGCAGCGCCGGGTCCTTCGTGCAAAATCCGGTGCGGGGGC
GTTTAACGCTGCACCAGAAAGTGCGGTGCTGGAAATTTGGGCGCTCTCATA