Description :
From Genome Similarity Track
Location :
contig_28:518327- 520020
Transcript NameFunction/comments
g6679.t1RAW42787.1 hypothetical protein PC110_g1021 [Phytophthora cactorum

Sequence
1693 bases(100 bases per row)
CCCAACGCGAGTCGAATCTATCGACGCCTCGGCTTAGCAAGAAGCTGCAGGTTGAAGATGGTGGCGACTATCTCGAGGCCAAGTCACCCAACCTGATGGC
CAAGGTCGAGGAGGGCGCCCTGCGTGAAGGTCCGCCGCCGGATTCTCGCAGCAAGACCTACTTCGGCTTCCTGTTCCAGTACGCAGGCGCTGGCCTGATC
TACAGCGTGCTGTACAGTCTCACGTACCCGTTCCTGAACAACTACCTGCGCATGTCGGGCATTGCGACGGCTTCCGCCAGCGTGCTGATCGCGCTGCCTT
GGTCACTCAAGACCTTCTTCGGTATCATCACGGATTGCTACCCGATCTTCGGCTACCGCCGTCGCCCGTACATGGTCATTGGCTGGGCAGTGTGCACGGT
TTGCTCGTTCGTCATGGCTGTGCTGCCTGAGGGCGACCCGTACTACCCGGACAACGCATGGGCGTCGCTCACTGAGTCGGAGCTCACTGCGGAGCAACTC
GCGGAGATCAACTACGGCGCCCCCGACGCCGGCATCAAGTTCATCCTGCTCATGATCGTCGCCAATTTGGGCATGGTGCTGTCCTTCACGGCTGCGGGTG
GCACACTTGTCGAGCTCTCGCAGCGTGAAGGAGAGAAGAGGCGCGGCGACTTGCAAACCATGATCTGGGTCGCTCGTGACGTTGGCGGTGTCGTCGCTTT
AGCTCTTGTCGGATTCGGTCTCAACTCGGAGGAGTACGGCGGCACCTTCTCGGGCTCCATCCGCGTGGGAGGCCTCATGGGCATCTGCGCCGTCACCTCG
TTCGTCACCGGCGCGGTGGCGTGGTTCTGCATTGATGAAGAGCGCGTGGAGCGTCGTTCCATGAGGGTGGAGGTCGGCAAGTTGTTCGACCTGATCCAAT
ACCGCGTCGTGTACCAAGTGCTGGCCTACCAGTTCTTCGGCAACATGTTCGCCTACGTGAGTGTGACGGCTGCGACCCCGCTGCAGAGCGTTTGGCTGAC
CATTACGCCCGTGAACAGCAGCGTCGCGTCCATCATCTCGACCTTTATCTCGATTGCGTCGCTTCTGGCAGTTCGTCAGTGGGGGCTCAACTGGAACTGG
CGCTGGATGATCGTGGTCACGGAGCTTGCTGTCGTGTTCGTGGACTGCTTCCCGACGTTCCTCACGATTTGGGACGTCGTCCGTAGTCAGTGGTTCTGGC
TGGGCGTGCCGCTTCTGGAGCAGGTGCCCACCAACATCGGCTTCATTGTGTCCACCTACTGCATGGTCGAGATCATGGAGGAGGGCAACGAAGCCGCTTT
CTACGGTCTCGTCGTCGCTGTGTCGAGTCTGGCGTCGCCGTTCGCCACGGTCATCACCAAGAACATCGACGCCAACTTCGACATTGCCACGGCCGATCTC
CAGCGTGACGACACCGAAGTCCGCCAGCAGGTCACGTACGCGTACCTGTGCTCGTACGCGTGCAAGATCTTCTCGACGATCTTCGTGCTGCTCATCCCGC
GCCAAAAGGCCGAGACGCAGGAGATGCGTCGCAACGGCGGTAAGAGTAAACTCGTGGGCATCCTCGTGGTCATCATCATCGCCTTCACGTACGTGTGGAC
GATCATGACCAACATCATGTCCATCTTCCCGTCCACCTCCTGCCTTAAGATCGCTGGCGGTGACGGTTGCTAGACTACTGCAAACTACTTCTG