Description :
From Genome Similarity Track
Location :
Scaffold_314:5182- 6335
Sequence
1153 bases(100 bases per row)
GTACGGTCCTTCCTGGGTCTGGCCGGGTACTTTCGACGCTTCATCAAGGGGTATGCACTCATCTTGCGGCCCCTGGAAAGTCTGAAGGTGACCGAGGAGT
TTGAATGGACTCCCGAATGTCAAGACGCCCTAGACACTCTCAAACGAAAGTTGGCAAGTCCCCCAATCCTGGCCTACCCGGATTTCGAGCTCCCGTTCAC
AATCTTTGTGGACGCGTGTCCGATCGCGTTGGGCGCCGTTCTGATGCAAGAACAGGGTGGACGGCACCGTGTCATCGCGTACGCCAGCCAAGCCTTGGAC
GCCACCCAACAGAGATGGATCTCGAAGAAAGACGGGACGTCTGAGATCGAATGCTTCGGGCTGGTGTGGGCCACAAGCAAGTTCCGACCCTATATCGACC
GCCGACACTTCACGGTTTACACTGATCACGCTGCGCTGGTCTGGCTGTACAAGACGGGATCGAAGTCGGGAAACGGGAAGCTGGCTCGGTGGGCCGTTCA
CCTACAAAGCCTGGACTTCACGGTGGTGCATCGTCCCGGAGTGCAAATGGGGTGTGCGGACGGTCTGTCGAGACTCCCGTTGGAAGAGGAAGCGGACGAA
GATAACCCTTTGGCCTCTCGATGGGACCACGAGGCGGACGAATTCATAGCCCAGCCGGTGCCGCGTGGAGGGCCCCGAGCGTGCTCGATCGCCCGAGGAT
TGGTCGGGGCCGTGACTCGAAGTCAGACGAGGGCGGCGGAAGCAGCCATGAAGGACGCTACGCCCGAAAATAGGACGACGAATGCCGAAACGGGACGGGA
TCCAGAACATGAGCCGCCTCCAAGGACCGACGTGTTGCCTCCGTACCAAGACGACACGTACGTACTCCCGGACGCTGTGCTTCGACGGGAACAAGATAAA
GATCCGTTCGTGAAGGCTATGAAGGCAAATTTGGACTCCGGGGCCCTGCCCATGGACACATGGCGCGTGGTGTTGAAGTCCCCTTTACGAAACCCGTCGC
TGAACCTCGTGCCCGTGATCCCGGTGTCGATGACGACCGACGTGCTGGCGCTGTGCCACGACTCGCCGTTGTCTGGGCACTTCGGACGCGAACGAACGAT
GGAACGGGTGCGACGCATCGCGTTTTGGCATCGGTGGCGTGAGGACGTGATCG