Description :
From Genome Similarity Track
Location :
Scaffold_129:51816- 53466
Transcript NameFunction/comments
Phypl_g3793hypothetical protein

Sequence
1650 bases(100 bases per row)
CACCACTCACTCGACACTGCGGGTAGTTTTCTGCTAGCCACTGAGCCACCTTGACATGTCCGCCGACCAATGCGTCCCGAACAGCTCGCCTCGTGCATCC
CTCGATGCAGTTTTCATGCAAAAAGCGAATAACTTCTAGGTGTCCGAACCAAGCCGCGCCATCGACTGCTTCGGTCGAGCAGCCCTCGGAACGGTGTTCG
TGTAACCATTTCACAACGTCCAAGTGGCCACAGCGCCCAGCCGCGTCCATTGCGTTTCGAGTACACCCTTCACTGCGGTTGAAGTGAAGGAATTTCATGA
TATCCAAATGGCCAAAGCAAGCGGCCGCATCCATCGCCTCTGTCGTGCATCCTTCGGACCGATTCTCGTGAAGGAACCGCACAACGGCAAGGTGTCCGCC
GCCTGACGCTCGATCGATAGCCCTTTCGGTGCAGCCTTCACTTCGATTTTCGTGGAGAAACTTGACAATGTTCAGATGGCCACCTCCCGCTCCCGAGTTC
ATCGCCCAGGGACTGCAACCTTCACTGCGATGGGTATGAAGAAActccacgacgtccagaTGACCTTCGGCAGCTGCGTAGTCGATTCCAAGGTACGAAC
AGCCTTCCCAGCGACGCTCGTGCAAGAACTTGACAACGTCGAGGTGGccgccacgtgcagcaccatcCATAGCGTTGGTGGTGCATCCTTCTGAGCGGTG
CTCGTGTAAGAACTTAACAACCTCCAAGTGTCCTCCTCGCGCCGAGCCATTCATCGCGTCCGTTGTGCATCCACCAGTTGTATACGCGTggagccacttg
accacaTTGAGGTGTCCATACTCTGCCGCTTGGTCCATAATCAAAGGCGAGCTGTCCTCCGCACCAGgggacagcagctcctccttgtgCTCGTAGAGCC
ACTGCAACAACTCGAGATCCCCGCGCTTCGCCGCGAATACCATCGCGTGAATGCTGCACCCCTCACTGCGATTCTCATGAAGCCAATGCACCATTGGGAT
GTTTCCATACCACACAGCAAAATTCATGGCGTACTTGGTGCCTCCTTCAGCACGATGAGCAGCTAACCACTCCACTACTTCGACATGTCCTCGAGCTCCC
GCTTCATCGATAGCATGATGAGAACACCCCTCACTCCGGTTTGTATGTAGCCATTGTACGACATCTAAGTGTCCGTGCGCCGCGGCCAAGTCCATGGCCT
TGGTGCTAGCCTGCACGTCCGGGATGGTCTTGTGAAGCCACCTGACAGCTTCCAGTTGTCCATGCTCAGCCGCATGATCCAGCACTCCCCCGTAGCCATT
GAACGCGGGGTCGTACGCTaccagccactgcagcatTGCAATGTCGCCTCGCTGCGCTgccgacaagaagcaacTGCGGTTCGATAGCGGCCGCAGACGC
CGTGAGGTGGCGcccaggcgctgcagcagatgcaaATAGCCGAAGTCCATCGCTTGGGGGATGTTCCAGAGCTGGGAACTGTCCAAATACGCCGAGATCA
GTGCGGCCACGTGCGcgaggaagcccagcgcctcctgccGCTCGCGCcacacgacgtccacgcaAGTGGGCAACGGCGTCCGAGTGGGGGCCATGGCGAG
TTGCGTTCCGCGACTGATTTGAGACGGTTCAAAACCGCGACGAAAAGGTG