Description :
From Genome Similarity Track
Location :
Scaffold_190:5180- 7056
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_190-fgenesh-gene-0.5GPI-anchored wall transfer protein 1

Sequence
1876 bases(100 bases per row)
CAGCACGTACGGGAGGTTCACCTGATGCAGTGAGGTATTGGCCATGCGGTTAAAGCGAGAAACGCGTCCCCATCGAACTTGGACGACATTACCATTCGCC
TCGACGGCCGCGCCACCAGCCGCACCGACATGTACGTCGACAGGACGAGGAGAACCGTGGCGACAGCGAGCGTGATGACGAGCCATCGCAGGTTCCGCAG
CGCCTTGGCTCCGTTGCTGTCGACGTAGCTGAAGATGACTTGGCCGATGTACACCGCCAGCAGATAGAGCGCCGTGTAGCCTTGGCAAGCGATCCCCGAC
TGTGAGTGACACCACGAAGCCCTGACCTACATATCCTGCACACGATCGATGAGACGCACCTGCCAAACTGAGGATCCCTTCTCGATTCTGTTCGAACAGA
GTGTCGCGCGGAGCATTGAGGATGAACTCTTCGCCATCGTAATGCGACAGATAGAACTGGTACGCTGTGCATCAACATCAGAACAGCTCAGCGATTTGAC
TCGCACAGATTGCCGACCGAGAGTTCTCGATTAACGTACCAAGCATGATGACAACGGCTGAGATCGGACTTGCCGCCCAGTCTCCGAACAACTGAAGCAG
CGAATACACCAGGTAAACGCCAGCGAGCGTGAAGTAGAAGTTCCAATGGACGCCGTATTCCGTCACGTGCTCCTGTGTGTGGCGGAGGAAACAACCACAA
CAAGCGAACGGTGTCAGCCACAACAAGACACATTTGTCACGAGAATCACGGCAACACACCTGGTAGTTGACGCCCTTGACAGTCAAGAAGCGAGCAACGC
CAAACACGAGGACAAGGGCGATCGGACGGAAGAACGCGTAGAACTTGCTCGCCAGAGATGTCTGGGAGGACTCGTTACTTGGACGTCTGTTGTCACGAGG
ACGGATATGTCCGACAATTGCACCACAAACAGTCAACAGGCGAGTTGAGTAGAGCTCGTTTTCACAATGAAGGCCGCACCGGGTTCCAGGAGCGCGGGGA
CGCTGTCGACGAGCATGCGCACTCACGATCGCCGACGACACAATGAAAGCTCCGACACCAATGTCCATCTATGACGTCAACAGACGTCGATTAGACTCTG
AACTCCATGGATGAAGTCGACAACCCAGCATCCAACCCACCACACTGAAGCCGAACGTTTCGGTCTTGGCGAAGCGGCGAGGGAACGCCGTGAAGTCGAC
CGCAAGGATCGCAAAACACCTGCACACCCAACAATCAAGTAAGCGTGTTGTATAGTCACTGGATCCACGAGAGCAACGAGAGCACAAATCGTACGTCGAC
AGCATGATCTGTCCGCGAAAGTTGGTGAGGAAGGGGAGCTCGCCGCCGAGCAGCTGGTTCATCTTCTCCTTGCGGCAGTGCTTGTGGATGTACTCCTTCG
CGTGCTGCCACGACAGCGCGCTGAAGATGGCAGCGAGGCAGTAGACGCTCACGAGCAGCGGCACTGCGAGCTCGGCGCGCGTGAAGCTGATCATCATGGG
GAGCATCGTGACGAGGAACTCGACGGCCAGCTCGATCGCTGGATGCTGCATCAGCCAACAGGTAACAGGTGAGCGACTACTATATCAGCCACAGCATGAC
GCGCCTCGTACAGCGTTGGCGGCGCCGACGGGTCGAAGGCCGACGACTTCGAGGAGCAGCATGAGCTCCGAGTAGAGCCAGAGTGTGCCCTGAAAGGAGG
TCAAATTAGTGCGTCTGGAGCGATCTGGCGCCGCATAATGGGGGAGATGCACACACCGGCGTGAGCGCGAAGAGCACAAACACCTCGCGGGCCGAGGTGC
CGTGCAGGTCGGCCACGAACGCCTCCTTGGCGCGCTTGTACGCGTCGCTCTCGCTCTCCATCGTCCCTTGATCGTC