Description :
From Genome Similarity Track
Location :
Scaffold_417:518- 5612
Transcript NameFunction/comments
g9626.t1hypothetical protein
g9627.t1hypothetical protein
g9628.t1hypothetical protein

Sequence
5094 bases(100 bases per row)
TACGCCTTCAAATGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAAGTACGCGGGCAGGATTCGCCCGCTGTCG
CAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGG
TGGCCGACCAATATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGT
GGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCCTGCCATGAAGTATGCACTCGCAAAGTTTCGA
GTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATAACAAAGAATGGCACGGT
GGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGCACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGT
GCAAGAGGCCGACGCCAACGCAGTTGGCGTCGCCAGGACGACCACACCCTCGTCGTCCTTGCTGGATGACGTGAAGGCCGCATACGCACATGATGCGGAT
GCGAAACAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCTCGTGTACACCGTTATCGTGTACACA
ATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGAATGATCATGAGTTGAAGCTCAAGATCACGTACGAGTACCACGA
TGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTT
CGTGCTTGCGAGGTATGCCAGCGTGTGAAGCCTGCGCCCAACTCGCAGGCCCCGCTTCAATTACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAA
TGGACTTTGTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATAGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCA
GCCGAGGTGACAGCCGAACAGACGGCATGTCTGTTTGTTGACCTGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCT
TTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACTCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGGCAAACAGAGCGTGT
CAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTACCGATGGCGGAGTTCGCCATCAACAACTCGGTG
CATGTCTCGACAGGACACATGCGTCTCGACAGGACACATGCCGTTCTACGAGAACGCCGTGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCT
CCTTCCTTAAGTGGGGGAGGGTATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTG
CGCGCAGTCATAGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGGCAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGA
GCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGCCGACAAGCCGTAATTCGGTTTGTCCAGGACGCGATAGCTGAATGCCGA
TAACACCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCA
AGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCCTGCACCCAA
CGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCCCTCGAGCGCGGCGACGCGCTTCAAGGCG
CCAGAGAGCCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTCAACAAGCTTAGCTCCTGACGCAGAGCAG
CGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAAGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCTCCCCCACCCACGTTG
CGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGATGAT
TTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGTCATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCG
AAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCGGAAAACTGG
CGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTACCCGTTGACGTCCCGCTCGATAATGCGTACTGCTCCGGGGTAGCAGTACTCACAAGC
AGTGTCATAAGGCACTGCGCAAGGAAGTTCGATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGC
GCCTGGCTAATCTGGTCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTTTGACAAAGTGCCTGCCACTTGGGCACTTTGC
TTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATGCAGTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGTAATCG
CTTCGCGACGTCATCGTCAACGATGGCGTTGCACAAGTACAGCGCGTATAGATTCGGTGGCGCGGTCGCACCGAATCAGCTGCTGATCTCAGACTGAGAC
GGCATCCACTGACTCAGTGTGCGAGGCCGCCACAACAGCGGATGGAGCAGAGTCATCTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGCAGCGAGCGGT
GTTCCACTGCCGCTGCGCGAACGCTTCGAGCCCGAAGCGTTCGAGTCGTCCTCGCGTGGACGACGCAGACCCACATTTGGGTCAGTGTGGCCCGGAGACA
AGGTGTCTTTGTCTCCTTCGAGTTCCTCCTCCTCGACTTCACTCCCATAGTCGAAGGGAACTCCCTCTCCACCAGGAGAGTAGATACCCACTCCGGTTTC
GACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCATGCCATCTCGAGTAGTATCCAGCAACAGAGAGGCGACTCTCTGTTGCCGCGCTT
GTCGACATCGCCTCGACGGCGATGTCAGTAGCGGTCGTGGCTGAGGCAGCGGCCGTCGTCGCTTTGGAGGCGACGGCAGCACTTGCTGTTGCCGAAGCGG
CCGGTGTCTTGGACGAAGACGTCATTGGCGTGCTCATTCCCAATGAGCACGTGTTCTCCCGAAGAAAATACGGATTGACGTGTCGAGACCGGCACGTCAA
ATCCTAACGGGGGGATGGTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGAATACATTCAGGTGACCACTCCACAG
GGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCA
ATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTAGCACCAAAGCTATCGTTCGGCCTCTTT
GTCTTACTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTTAAATACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAATAG
TGGGTCTAAGCAGACCCATTACAGATCACGCTTAACCTTCTGGACGAGCTTCTCAAGCCGAAGGATGACGACGGTATTGTCCGTGTGTCCGCGGTGACTA
GTTCAACGCGGCGTCCGCGATCGCCGCCCGACGCTCTGCAGGAAACGGTCGTTCAGCGCATGCGAAGTGAGCGAGTCGTCCAAGCCCAGAATGAGGAGAA
ATGGATCACCGACCTAAAGGCGTACCTGAAGGGAGACGTCGGTAGCTTGACGGCGAAGGAAGCCAAGTCGTGTGCCAAGATCGCGGACGATTACGAGCTG
GACGAGAGCGACTTGTTGCTCTATTGTCCATCATCCATGAAGCAGGACGAGGGTCGGGATGAGATCGCAAAGTTGGTGGTCCCAGAGACTCTGCAACAAG
ATTTCTTACATCACTATCATGCGAGTCTGGAAGGAGGGCATCGGGGGATCGGAAGAACGTACCGACGAATCCGATCGCATTTTTACTGGAGAGGCCTGTA
CCGAAGTGTCCAACACTACGTGGGAGAATGCACAGACTGTGAGACAGGGAAAGGGCGACCCTTCGTGAGAGGGGAGTCCCCTGGAAATTTGCAAGCTACG
TACCCGTTCCAGATCGTCACCATGGACCACATCCCGTCGCTGCCCAAGTCTTTCAAAGGCAACACGGAGCTGCTGATCTGGGTAGACCTGTTCTCGGGAT
ATGTGATCGCGAAAGCAAGTGCGTCACGGACGGCCCAGACGATCGCGGAGAATTATGAAGAGTGCGTATTCCGCCGTTTTGGAGCCAGTGAAGCCATCCG
TCACGACAGAGAACCCGGTTTTATGTCTGATTTCTTCCGTGCATTCAGCCGGATCGTGGGACAAAAACAGAGAGCCACGATGGCGTACCGGCCC