Description :
From Genome Similarity Track
Location :
Scaffold_180:51798- 54451
Transcript NameFunction/comments
Phypl_g4815transient receptor potential Ca2 channel (TRP-CC) family protein
Phypl_g4816hypothetical protein

Sequence
2653 bases(100 bases per row)
TTTAACGGATCAAGCCGTAAAAAGCCCCCACGCGCGAGCGTTGGTTGATGAAATTGACGAAATCTGGGATCCACCGAAATGTATTTATTGATTTACCGTC
CACCAAAAGCTGTGCAAGCGGAaccagcagccagcacgaGCTCTCACGATGCCCGACCCCTGCAGACTCGCCTCACTTCAGAATGTGCAGCACGGTCTAC
CTTCTGCCCTCACCAGTCAGTCGTGCCACGATTGCGTATAATGTGACCATAGTTCCGGATGGCCTCCCGCTGTGACTCCATCACGCCGTTTTGATCACCA
GGAGGATTTTTTTTTAAGAGCTCTGCTGCGTATCTGGACGGAGACTCAGACGAGAGACCGCCGATCTGCCAAGAGGAGACAGTAGCGAACTTCAATCGAC
GATACGTCGTCTTAGCTATGGGATATAGTATATCCAAGGTATATCCGATATACCTTGGATAGCCCTTGTGGGCAGTCTAGGTGAGGACGAGTTACTGAGG
ATGCTGGACATCTTGAGTTGTAGCATCCCCTTGCAGTTGATGGACAGATGGGAATTCGGCAGAATACTCGTagctactacgtagtactagTATTTCCTTG
TGCGGTCGACTTCCAACTCAAAATTATAAATTGGATACGGCTTCGCGAGACGCACACAACGCACACAACGGCGAACTTCAGTTCGTTTGGCTAATTGTTT
GTACGTCTTACTTGCGTTCAGCTCGCTCAAAATTCTGGCGTGGGTTATTTATCCGACCGTGCGAAGCTTTCGAAACTTTCGAGTCGTGCGGGCTGTCATT
GATACTTAAGTATGCGGCTGGGAGAGACTAACTGTGGAAATGGCCCCCGCAGCTTGCTCAAAGACAAAGGCAGCACCTGGAGCTTCGATACCAGTGATCG
GGCCTTGAGGTGCGTCTGAACTGCCCTGTACGCGAGAAAAGCATAATCCGCAaggcgatggagctggagaaaaTCAACAGCGAAGGTACCGCCGAAGCAA
CACCGAGTTGCGCGCTAGATTTCGGCGTCATGATGGGTAGCGGCATGGCCCAACTCGTGTTTCTGCTTCCGTTTACAAAGAAGCACAACTTCCGAACCGA
CGAAGACTCGCCGACGCGGAGCGTatctccagcgcgtcgtcgatCCAGTATCACGCCTCgtggcagcttcagcctcaTGACAGCCTCAGTTGCCCCCATC
AACTCGGGAGATTCTCGCCCAACTCCTACCATAGACGACGAGGTGCCACGAACACGACAATCCGTCGAAATGCGCTGACACTGAATGCTCCCGCTTATCT
CGATATATTACGCAGCCTTTCCGACTTTAAGCACGGCCGCCGAACTTTTGCATGAGCTTGGACCCCTTCGGGACGTTCTTGGGGAAGCGTCCTCCCAGGC
GACCGCCTTTCCCCGCCTCGGACGAGTCCGTGCTCGCCGTAGACATCTGCAGAGGCACACAGAATGGCGTCAGCACACAACCAAAGCACCAAGAAGCACC
GGAGTTGCACGAAGCAGTAGCTAATTACCTGCCGCGCTCTCTTGAGGTGGTCCTGGGTCATGCTGCCGTGGCGAGAGAGCGAGCCGCGCACCGACACGGG
GCCGTGGTCTttgttcttcttgcgcttgagcccatgttgctcctgctggcggcgccTCTTGTGGTCCTCCTGGCtctcggccagcgtcgtctgcCACAGC
GCGCTCCacacgcgcttggcgtccCCGGCCTCGTCGTGGAAGAGCGCCAGGATCTCGCGAAAGTCTTTCTTCCTCTTGGGCTTCAGCGGCTGGTTGGGGG
TGGGATTGAgcgtcggcttcttcctcttgagctcgtcttgcggcggcggcggcggaggaggaggcgggGGCAGCGGCGCGTCCGAGGCCGCTTCCGAGTC
GTTCCcgtcctcgtgctcgtccttcATTATTGTAGTAACAAATGATTTGGGTACTTTTTGCGACTTTGTTTTGATTTGGGTACTTTTGCGACTGTTTGCA
AAACGACTTCTGCTGGTTTGCCCCACGAAACCAGCGCCGGTCTGCATTGTGAAATGTCGTCACGTCGCGCCACTCGCTAGAGGAGAACTGGCCACCGTCG
TCTTTAGACGGAGTGCTGGTAGCTGAGCAATGAGAATGCATTGCCATTGACATGGACATTGACATCTCCCAATAGTGGGAGACTGCGCCCCGCAACGACT
GGCTGCCGAGCGTCTACCGCTCTGTCCGAAATACCGAATACTAGTACATGGAAACGCTGCTGACTCATAGCCAGCGCTAAATCGGATACTTCAGCTCGAC
TCGGCTTGACACCAAAGAAAAAAAACGCCGGTGGATAGTGGCACTACTTGGCACAATTCGCCgtggctggcgtcgtcgccaccaccgctCCTCGATAGCG
CGATGAAGGCGCAGCATGTTTGAGCGCAGCCGACGGGGTGCCAGGTCTATCTAGGTATGCCCCCAGCTCCATGtggtgaagttgaagtgctccaCCGACA
TGGCTGCCAAGATGGTGAAAAGATAATAAAAGGTAAATTGATTAAAGGGTTAAACGCGAGTACTACGACCACTCGTACTCGTACTCGTACTCGTAGGACC
ATCTCCGAGTGGGTCAGACGCACTTCTTCCGAAATAGTGCGTAACAGGGCTGT