Description :
From Genome Similarity Track
Location :
Scaffold_68:51791- 53379
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_68-fgenesh-gene-0.560S ribosomal protein L13

Sequence
1588 bases(100 bases per row)
GCATACTGGGCCCAAATGAGCTGGAGGACTGGTTCTCCTTGGCGTTGGGGAACCACCAATTCCCGAGCTCTTGGTGCCGTTCTTGCCGCCGGCCATTGAG
AGGCGCCAAGTTCCAAATTGACAGCAACTTTCGGAATAACTTCCCGCGAAGGTAAATGCAGCCAGCCAGCAGCGGCGTGGGGTGTCCATGCCTGCTCTCT
GTGCTCTGTATGTGTGTGGTGCTTTGCTGTGCGAGTGAATGGCCTCGTGTCACTCGCTTGTACTTGTGTGGAGTGCTAATGACCATGACATACGGAGATA
GAGCAGCATGACTGATTGGATGGACGGACACCTGCTTGCCGAAAGTGATGACATGGATGAATTGCTTTATTAACGACTGCTAGTGTGTGTTGCTTTTGGC
TGTGTAGTTAATCGAAAATGGTGAAGCACAACAACGTTATCCCGAATGGTCACTTCCACAAGGACTGGCAGCGTCGCATCAAAACTTGGTTCGACCAGGT
AAGAAACCCACTTCCATTTGCAGCAGCGGCGTATTGAATAGAGTGGAAAGAGAGAGAGAGAGAAATGGTGGAGCCCAGAGATGAATGGTGAGATCAGCAG
GCAGGCGAAAAATAGAGTGAACAACAGCAGTAACAGCAGCAGCAAAGGCAACAGAACAGGAGATCGTCGCACTGAACAGGACGCAGCTAGCTGTACGGGG
TGGAGATACGATGAGGTGGCGGCTCACAACGACCATCATTCAAATCAGATCAACACCAACTAGTATGGCGAACACCACCTGAACCAGTTGAACAGCAGCA
GAAACACCTCAACAGCACATGCACTACTATTCCAGACATACGTTCCAGCAGCGTTCCAGTCCAGTATCGGCCCACCTCCTCCAGACCTCTTCTTTCTCTC
CTTAACCAGTCAGCCAACTCCTTGCATGACCAAAACCCAGGACCAATCATTAACACATGTTTTATCTTCTAACAGGCCGCCAAGAAGAAGTCGCGCCGTT
TGAGACGCAAGGCTAAGGCCGCCGCTATCGCTCCTCGCCCAGCGGCCGGTCTCTTGCGCCCAGCCGTGCACTGCCCAACCGTGAAGTACGCTTCCAAGGT
CCGCGCCGGCAAGGGTTTCACCCTTGAAGAGCTCAAGGAGGCTGGCATCCCTCGCAAGCAGGCGCTCTCGATCGGTGTCGCCGTGGACTTCCGCCGCACC
AACAAGTCGGTGGAGTCGCTCCAGGCGAACGTGCAGCGCTTGAAGGCGTACAAGGCCAAGCTCGTCGTGTTCCCACGCAAGAACATCAACAAGCCAAAGA
ACGGCGACGCGTCCCCAGAGGAGACCAAGAACGCCGTGCAGCACACGGGCGCGCTTTTCCCAATTACGCGCTCGGTTGTCAAGTCCACCACCGCGGTCAT
CACCGAGGAGATGAAGGAGGAGAGCGTGTTCAAGACGCTGCGCATCGCGCGCGCCGATGCCCGCATCTTCGGCAAGCAAAAGAAGCGTCTCGCTGACAAG
GCCGCCGCCAAGGAATAAGCGTTCGGTTTTGTCAATCGACACCAGCCAGGGCTTCATTTGTGGAACGATATTGGAACAAAATAAATCG