Description :
From Genome Similarity Track
Location :
Scaffold_98:51786- 54375
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_12479pdr transporter

Sequence
2589 bases(100 bases per row)
TGGTTACGGTCCAGCAAATGCGCCATGCGCCGCACGAACGTCGACTGGACACCGTACGCTCGGATCGTCGGGAGGCCGTCGAGCGTCTCGGCCATGAGCG
CGTAGAGCGGCGAGCGTGAGATGGACTCGAGGCGCTGCAGCTCCCGCGACGTCTTGATAAAGTAGCGCTGGGACGCAATATAGCCGACGCCAAGGGGCAG
CAGGCCAAGCGCGAACGCCGGCGTGACGTACACGATCGTCGCCAGCGTCGCAGCGACGCTGCAGAGCGTGATGAGAACGTTGCCGACGGTCGCCGGAATG
TCTTCGTCGGCGGCATACACGTCCTTTGAGAGCCGGTTCACAATGCGTCCTACTCCATGCACAGATGCTAAGTACCAGACAATTCTCAAATGGATCTAGA
CCAAGTGGTGTCGTATCGAAGAACGCCATCGGGGCGCGAAGCACTTGATAGAGCATCGAGGCGAAGAGCGCGCTACTGCCTCGGAGACCCGCGAGGTACA
AGAGCAGTACGCGGAGGAAGATGAATGCGACGTAGCCGAGGTTGAGCCCCACAAAGACGTAGAGGTACACACGGCGGTCAGGCTCGGACGATACGGCGTC
GTTGGCCGCCCACGCTTGCAGCCAGAACGTCGCAAGCACGTTCGTGCCTTGGGCAAGAAAGAAGACGCAGAGGATGCTGCCAAGGACGCAAAAGCCGCCG
CACGCGCGCACCCAGACACAGTAGACGCGCCAGGCGACGTCGCCCGTGGACCGGTCCTCGTCGACCATGAGGTGCCGGGCCTTCTCCGCCACGTCGCTCG
ATGGCACGCGCTGCAACTGGTGCCCCGGCGTCGTCCCAAACTCGTCGTCCGAAATCACATCGTCCGTCGATGCGTCCTGCACGGGCGGCGGAGTATAACT
CGACACTAACGCCTCGAGCGCGCTCTCTGGTGCGGCGAGCAGCGCGTCGTACGCACCGACTTGGGCCACCTGACCAGCATTTAGCACCACGATGCGGTCG
CACGACGGAAGAAACTGGAGCGCGTTGGTCACCAGCACGACGAGCTTGTTGCTGAGCGTGCCGCGGATGCACGATTCAAAGATCGTTGCCCCGACGTGGG
CGTCGACGGCGGCGAGGACGTCGTCGAGGAGGTAGACGTCGGCGTCTTGGTACACGGCGCGCGCGAGGGCGACCCGCGTCCGTTGACCGCCGCTGAGGTT
GATGCCTTTCTCGCCAATCTCGGTGAGGTCGTGTCCCGGCAGCGCGCGGAGGTCGTCGTCCAGGCACGCGACGCGGATCGCGGCCATGTACCGGCCAAAC
TCGTACGGTAGCCCGAAACAGATGTTGTCGCGGACCGTGGCATTTTGGATGAACGGCTGCTGGGCGACGTACGCGATGCCGCCGCGCACGGCGATAGTGC
CGGAGAGGCACGCCGCGTCGCCAAGCAAGCCTGAGAGGAGCGTCGACTTGCCACTACCGACGGGCCCGACCACGGCCACGAGCCCTCGGTCGTGCATCGT
GAGCGTGAGCGGTCCCAGCGCCGGCGCGGTCCACCCAAACGTCGCGTCGACAAGCGATATGCCAGTACGCGTCAAGTCGCCGCTGCCAACGGGCATCCGC
TCGGCGTCGAGAAGACACGCTTCGAGGCGCGTGAGGCTCACGGACGCCTCGACGATTGCGTTGACGACGCTCGGCAGCACAAAGAGCGGGTACCGCATGA
TCGCCAGCAGTGCGAGGCATGTGATCGACGTCTGCACGTTGAGGACTTCGTGGTAACCAAGAACGTACGTAGCGAATAGCGCGACGGTGATGAGCGCCGG
GACGCCGTTGAAGATCGAGTTGGACGACGCGCGCGTGAGAATGTACGCCTTGAGCTTCTGGAGCTCGTCGTCGCGGAAGCTCTGGACGCGCTTGACGAAT
TCGTGCTCCCATGTTTGGAGCTTGATGACTTTGATGCCGGTCAGCACCTCGTAGCAGACTTTAATGCGGTCGTCCTTGACGGCCATGAGCGCCTTTTGCA
AGCGTCGCATGCGCCGCGAGATGAGCAGCGAGAGCGGGATCGAAAGCACTATCACGCCGAGCGCGCCAAAACACGCGGGCCCGACCTGGTAGTAGAGCAG
CGTGCAAGCCGCGGCGATGAGACACGGGCCATACCAGATCGCGTGCAGGTCCGAGAGCAGGTCCTGGAGCCGCGTCGCATCGATAGCTACGAGGTTCGTG
ATCTCGCCCGACGACCGCAACGACGACGACGAGAGGCGAAGCGCTTTCTGGTACACGGCGGCGACGACCGCGCTACGCACGAGGAGACCCGTCTCGAAGA
CGTAGTACATGTAGTTGCGGAAGCAGAACGCTTGGAGGTTGCCCGCGATAAAGATCGCGGCGACGCAGAGAAGACCGTCCGACTCGGGCGCCAACGGGTC
GCAGAGGTACGCGATCACGCGGTGGATCACGAGCGGCCCGACAAACTGGAGGACGTCGCGGAGGAGCCGGAGAACGCCCGCGGCAACGAATCGCCGGCCA
AATGCGCGGGCGAGCGCGCGGGCGAGGCTCGGATGCGGTCGCTGCCGCTCGGTGTCCCAGCAAGCTTGGAAGCGCGCCGATGCTACGTC