Description :
From Genome Similarity Track
Location :
contig_84:5177- 6640
Sequence
1463 bases(100 bases per row)
AGGTAACCCCGTTACACCAACGGTGAAAATCCTGGGCAAAGCGCTCCAAGAACTCAAGAATCTCGGAGGCGCAGCAGAGACGTACCTCCACATTGACAGT
GTGGATAAAACAATCCAGAAGGCCCTCAGTGCAAAACCAGAGACAACAAAGAGCGACAGTCCCATCCAGGAACTGGGCCACAAGCTACGGCGTTTCTTTG
GTGTGCAATGGAGCACACCAGCAAAAGCAGTTCGGACACTGACGAAAACACACCCGACTCGACAATTCAACTTTCAAAACCCCAGATACAATGCTGGAAT
ACCTTCTATAGGAATAACATAAATATCAAATAGAAGGCCACTTAACTCGGCACATGTACCCCCTGAACCATCGGCCCCGACGAGACACCGTGTTACACGT
CGTCTTGAGACCTCCATTGGAAATCTAGGCGGTGAGGAAGATGCGAGTGACGCCTCCTTGGCTCAGTATTCGTCGGAGTTATGGAAGCAAGAGGGCCACC
AAGTCCTCTCGCAGCGGTGGAGAACAGGTGCACAGGAGGGCCACCAAGTCCTCTGTGCTTTGGTGCTTGAACGGAAACGCGACGGGTTCACCAGGTGTCA
TGCCCGCGTCTGGCTGCTTAGAAACCAGGCCAGAGCGCATGGGCGCGAAGGCTCTGCCATGCTTGCTAAGCAGCCAGAAGCACTTGTGTGACGGCTGTCT
TGACGGGCCAGCAGTCACAGTGACCATGCATATAGTAACAGTGACCATGCATATAGTAACAGTGACCATGCATATAGTAACAGCGAACATGCATTTAGGT
AGATGAACAAGAAGTGCCACAGAAAAAAGAGAAACACATGCAGGGTAGCAGCAAAGGCACGAAAAGAATCAAGCAAAAAGAAGCTAGGACGCCCCTGTAG
CACAGGAGGGCTTGCATGTTTAGGAGGACCAACGCAATTCATTATCAAATACACACACCAACCCGCATTTCGACTAAACGACCATGGCTTCTAAGCAATA
GCAACTTCAACGACAAACACTCTGTTGACGTGGAGCGCCGTTAGGATGCGCGAAGGACGACGACAGGGACTCATGCAGTGATGACCTGCGTCGGATAGGA
CGACCAAGGCACGAGCGGCACGTTCCTGGGCATGGTGTGTTTGGCTGATATATCCTGACTTGGGTTAAGTATGAGGAACTTGTCGAGATCTTATACGCAT
AAGATCCCGACAAGATACAGCATACTGGAATCCAGTCAAGATGGCTAGGAGGTAATCAGGACGATGAGATGCAGCAAGGAAGCCCAGGGAGAGCAGTAGA
AAAGGAGGACAGCGTGTAGATTGTAGAGCTAGCAATCAATCTCACTTCGGCATTTGCCCTCTCCAAACCAACACACTCTTCTCCAGCTAAAACTCGACAC
CAGGCCCCAAGCGCTGTCGGTGTGAGATCTTGGACACGAAGAGGACATCAGGCCCTCCGTACG