Description :
From Genome Similarity Track
Location :
Scaffold_1966:5177- 6411
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1966-snap-gene-0.5Aspartate racemase
Pytar_ATCC12531maker-par_contig_1966-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
1234 bases(100 bases per row)
CTCGTACCTTCTCCATGTGCATCGAATGAGACACGTACGAGAACGCTGCACTGCCGGCAACCCAAGTGAGTCATGTATGGATACAATAGAACCCCCACCT
TGTTCATTATTATTTCGGAATGCGATCACATGAACGACGCCGTGAACTGGTTCAGGAATGCTGCCGCTTGAACAGCAGCGTCCTTGTCTTGCTGCGAATC
CTGGACTGCTTCCAGAGTCACTGGCGGTTGCTGCTGGATGTTCTGTTGTTGCTGCTGCTGCTTGAGCTTTTCGAGCCGCAACTGCTTGCGTCGCTGCTTC
TCCGTCAACGCCGACGAGTTCGACTGCTTGGCATGCTCCACGCTCGCGTGGACTTGCTCAAGGTACTGTTTTTCGTCCGGCTTGAGCGTTTTCTCCCACT
GCGAGACGACAAAGGAGCCGCCGCTAGGCGCTCTGTCTTCCTCTTCCCCTTGATGACGATCGCCGTCTCGGCGTTTGTCCTCAAAAAACAGCGAATCGGT
TTCCCCCCTCGTGCCTCGCTGCACGTACTCGACGTGGTCGCTACTGCCCTTCTCCACAACACGCGTGCGCCCAAACTCGTCCGTGATCTCGACCGTCTCG
GTCGCTCGCTTGTACTGCCCGTCCGCCACGAACGCATGCGAGTCTCCAGCTTTGCGTTTCCCATCAAAATCCACGAGACAGTCTTTCGCTGCTGCCGCGG
GCACAGCGTCGCGCTTTCCCTGCATCATCTGGTCGTAGAGCTCCGCTTTGCGAGCGAGCATCTCACGCGATTTCTTTTGGAGCGCAGCGTCGTCGTCCGA
GTTGTTCACGTCCAACTCGCGCAGCTCGTCGTCGCGCCGTCGCCGTTCCTCGACTCCGCGGTTGCTGTCCTTCTCTCGTGCACCTCGACGGCGCTTCTGC
GACTGGAGGCGCGCGTACACGCTGTTGCCCATGGCACCACCATCTCCGTTGCCATCGCCATCACGGTCCGAACGCTTCCGGCGGCTCGAGCGTATTCCGT
TGTCGCCGCCGGCTTCTTCGCGGAGCTGCCGCAGACGCTCCTTACGCTCCTGCTCCTTCTGGAAGACGACGGCCTTGAGATCCAGAATCGACTTGGAGTC
GACCTTGATTTGCTTGGCCTTGGACGGCAGCAGCGCCGACTCCGTCAGGAACCCGAGCGACATGCTGAGGATTTACAACTGCTTGACGCTCTCAGAATGG
CACCACCTGAAAACGTTTTACGATAAAACCCCTC