Description :
From Genome Similarity Track
Location :
Scaffold_98:51765- 56581
Transcript NameFunction/comments
Phyta_totarag3534hypothetical protein PHYSODRAFT_467853

Sequence
4816 bases(100 bases per row)
TGCGTCGAGATGCGGCGAGCTGTCCGATTGATTTTCTTGGATGCCTCTGCGATGGCGTCGTCAATAAGTCGCATCCACTCAGCTTTCGAGCTCGCGTTGT
CAGCGAACACGACGAAGGACTTGACCGGGTTTTGAATTTGGAACGCGTGCTTGGACATGACACCGTCGGGGATGTTTGAAATACGCGTGAGTTTGAGACG
CAAGGAATTGTGCGGACTCCACCTTCCGGTCATGCTCTTGTCAGCATATAGCAACTGGTCATTGAAGAGGAAAAATCGGTAGAGCTGGTTGCGCGACCTG
CACTTCTTCGTTAGGTCACCCTCGTGGATGAaagtcgtcgagttcttgagGTAAAAGTGACCACGATAAATACGCTGGATTACCGAGTCCAGCTTCTCCG
ACTTCTGACGCACTTGAATCGTCTCCTTCAACTCGTTCACGAGAAGATGAATGTCGCCCATGGCCTTCCACGGATCATCGCtagcagcggcttcttcaaT
GGTTCGTGCCCACTCGTACCTCGTGTCTTCAGGGATGATTTTGCCGGCATTGTTGGCTGGGTCGCCCCTGTGCTCCTCGGCATCCTCTCGATGAGCTCCG
CCCAACGAATCCTGCACCTTCCGCAGCAAACCGCAAAATGCCTGTCGCTCCACAGGCATATTCAAGAACAAGCAGGTCGAGATGCCGAATCGCAACAGGT
CGAGGCACTGCATCCTCGTGGACAGATCCGACTGGTTGTCGCACAGGATGGTCGTCGATAGAGTGAGCAAGGAAAACCACACGCGCTCGAATAGGATTTT
GATCAAGTCCGGACTGATGGGAGTGTCGACGCCGACAAACTGGAAAGTGTTGTAGGCGTGAGATAAATCCTTCATGAGCTCTTCAGATTGAGCTACAGCC
TTCGCGATACCGCCGCGGAACTTCTCATTTTCCAGATCCGCAGCCGTGACACTAGCTTCGCGCGTGGTTTTCGGGATGACACGGCTGCCCTTGATGTGCA
TCGGATTGTGGGCAATATCGTCGTAGATCTCCTCGAGAAACCGCTTTGGAAGATCCTTCCCGTTGTCAATACCTCGGTTGTTCTTTACAAACTGCTCCTT
TGacattttgtttttcttcacCTGCGGGTTGTGCAAATCTGTGTTTAGCATGATGATTGAGTACGCAATGATCATTGCGGTGTCGGCAGACGAAAATGCT
GTAGGCGAATCATCCCAATAACATTGCGCGAACGCCTCAACCATGCGCTCAATCTTTTGAGCCTCTCCTGGGAGACGGAAGCCCCCGTTGGTCAAGAAAT
GCCGCAGAGACTCGACGAGTGTCATACCCTTGAATGATATAGCCCGAACATACGTCAGCCGAACTTGGACTTtgaagtcttcgtcaccTTCGCCCAGGTA
GTCTCCGATTTCAGTCTCATCAAAGAAGTCGTGGTATATCCGTAAGAACGAGGTTATAGTACGTGGCGTGTCTTTGATGAAGTTCATGGCCACCAAGTAT
TCGAGAGCCTTTTTCAAGCTTTTTGATGAAGAAATTTCCATCGCACGCTTCAATAGCTGTTGGTTATGTTTCTGAAGTTCATTTCGCATTCGAACCGAGA
TGCTGCCACCGTATTTGCGACCGGATTGACGCTTCAACTCATGGCTCTTGGCCTCCGTAGGTGAGCTTGGCTGACTTGCTCGATCGTCTCCGTTAGCCGG
TATAATAAATGAATTCTTCATTGGTGATGCCTCTTCACCCGATTCATCCTGTTCCCAACCTCCATTGTCCATCGATAGCATACGAGTACGCTGGTCCCGG
CTAATAAGGTGGGCATGACCACTAGCGTCCATCACGCTGCGAGCCATCGCTAGAATCGTACTAATTGCCTGATTTTGTCGTTCCAGGGCCGAGTCATCCC
CCTCGTCTGCATTCGCGATATGACCCATGTTACCCTCTCCGATCGAACCAAGGGTTGAGCACAAGTGTTCAAATATTTTCCACTGCTGAATTCGATCCAG
ATCGAAGTTGAGAAAGATCTCAACGACATTGTGCGGAAGCTGTAGCCACATAGTCATCTCGTGCATGATCTCCAATTGGTGATTCTTTGCACAAGGCGCA
GTAGCTCGTAGAATtcgcagcaacacgtgctCAAACATCAGCGCCAACTCGACCTTGAGATACCGCCGGTAATGGTTCCACAATGTCGATACCAACGTAA
GGTTTGCTCGAAATATATCCGGCACCCAAGTGAGCACTGTGGAGTTAAGCGTTGATAGCACAAATCTCCGAACCACCTGACCAAACACTCGCTGGTCACG
AGCTCGCGTTCCAGCTGCAAGGAGTGTCTGGTTGAGGGCACGAAGAGAATTCACACTCGAGCACTGGTCACTTTCAGTAGTCGTCTCACCAAGACTTACA
AACTTGCGGTTAACCGCTCTGCTGAACGTCACCACTAGTTGGAGGGCATTTTTCTCGGCCTGGTGAATGCAAGTTAGCATTGTGGCTAGAGATAATGGAA
ATTCATGAGGTACGCACCACGGAGTTGGCGAAATTATTCATCGCTGCAGAGATGTCTTGACAAAAGGTGAGTGACTGAATGGACAAATGGCTCTGCATCA
CAAGGATTACAATGAAGTAATAGTCAGTCTACTGTCAGCACAGGTATCGACGATATGCGTTGAATTTTACCTTGAACACGCCCAGCATATTGTCGGTAAT
GGTCGCGATTTCAGCGCCTGTACTAATGTCGTCAACGAGGTCAACAACTAACTCATGAGCTAGAGCCTCCGACGATTTCTCGAGTTCCGAATTAGTTTTC
TTGATGACTGCAGATTTTGTGTTGATCAAAATGGCTTCGTAAGCGTACATGATCTTAGAGATCAATTCGTCCTCAAACGTCTTTGCAAGGGAGCCGTCGA
AGTCTCCAATGAATGTTACAGCTTTCAGTATGGTATGAAGTACAGAAGGGTCAAACCCTTTGGTGCACTTTCGAATGACCTTGTAAATACATGGGGCCGA
GATTAACTGAGAATTGAATGATTTACCCAAGATCCAAATTCATGCACCGTACCTTGTGGAAGAATTGGAGCGCAGGCTCAAAACGAGATTTGACCCCTTG
TTGGCATATAGATGTGACTGCGTCGATCACCACCTCAAGACGGCATAGCTCAGATCCGGGACAGTCGAATACACCTTCATCGAGGCAATGAGTGAGTCCT
GTTATGGCCGCTTCTGCGGCATTCCCGTGACGAGTGTAGCACGCCAGCAACAgaggatacatgtagtactcAATTGTCTCTTTCCAGCCTATATGTTTCG
CTTGACAGAATACGCACACCAAAAAGGTAAGTTACACGACCAATTATGCTAACTGTGAATAATGAACGTACGTTTTGGTAGAGGTGAATCGCTTGAGGCA
TCAGAGCTAGGAGCAGCAATCAGTTCTTGTTCTCGCAACTCCGTCGATTTTAGAGCAAAGGCAGATTTTAACTGCTGTAATTTGCCGGGCGTAGAtggcg
gtggaggtggtgaaCGGGTACGCTCGAGCGCTTGAGGAGGAGTGACAGATGCAAAAAGCCACATCTTGTGCAGTTCACTAATGCTAGACACCTGGACACA
CAATGAGAGGTCAGTCACATTGTGTCGTTAGAAAACAGCACGGGCGCGCAGGATAATATCACGCCTTCtaccttcttcttgtagcCGAGGAAAACTTCTG
TACCACCGGAAGTCGAGTTAAGATCAGCGACGTGACCAAGTGGAGATTTATCTACCTTCATATAGCTGGGGAATTTGTGATGTCAGACACTCCAGAGTTC
ATAGCATCCATCCAATAGTGTTTACAACAATGTCTTCTTACCCGTACGGAAGTGTTTCGCTTTTTCTTGGGAAAAGCACTACCAGATCAACGATCGCTGA
GGTAGCGGACCGTTTGAAGCAGAGGTAGATCTTCTCTCCTTGCGTTCCCTGCCCAAACCCAGAACGAGCTTAGTTTCAGACCGTCTTCGTCACAACTTAG
AAATGTACGTCTTACCGTATTAATATTCGCAGGAACGCCGCGCCGTCGGACCACCTCATAGTCACTAGGAACGAATTCCCCTCGTTCAGGGAATATAGCA
ATTATCTCGCTAATCGGTGCCTTTCCTGAAGACTGATCTTTGCTTTGGCACAGGTACACAAAAGTCCCCCTTCCGCCTTTGTTTAGATCCGCTCTCTGGC
CACTTGGAGATCGTTCCAACTACGCAAATACCTTGTGTGTTAACCAACAGGGTACCATAATAATTTACAAGCACCTTGCGTTGCGAACGCACCTTGGTAA
ATCCATCTGGAATGGAGTCTCCTCTGAAGATCACCGTGAGATCCATCATGGGGTCTTCATTCCCATCAATTATCTTCCACCGCGGCAGCTCACCAGTAGT
AATGCTGGATCCATGATACAGTAGCCACGATAGTCAGTATTACTCTGTGAAACAAAGCGTTCGTTGTTAAGCACTTGCAGGTGATAAGTTCTTACTTGTC
GGAGCTCGGACGTCGACTCATCCGTGCCTTTCCCTTCTCCATCGCATTTGGCATTAGCGCCATCAGCCGTTGAGGACTTTTCGGCGGGGCAAAAGCTGCG
GTACCCTTACCATTTACAaccccaccaccaccatcaaggGTCCCCGTGATCTCATTATTGCATTCGTGACGATGAGCAAGACTcttcgctgcagctactc
gaTCCATTCTCGCTAGCGTTTCTTGACAGATCTCTCGGATGCacgccagctcgtcgtcatcggcaGCAGTCTCATCCAAAATGGTATTGATTCCGCTTCG
AAGTGCCGCCTCATGC