Description :
From Genome Similarity Track
Location :
contig_23:517635- 519687
Transcript NameFunction/comments
g6119.t1hypothetical protein

Sequence
2052 bases(100 bases per row)
CAGCTGCGCCATCTGACGTCGTTGCTGCAAGCCACGGAGGGCATGTGCAAGGTCACGGCTATTGCCTTTTCGCCCAACAACCGGCGACTCGCAGTGGTGA
CCGTGGACCGCGTCGTGCATTTGTTGACGCGCAGACTGGCGAGCGCAAGGACAAGTTCTCCACCAAGCCGGCCGATAAGGTAATGGAGACTTGTGTGCTG
TTCTATTGTGGTTGGCGACTCACTTTGCACAACAGGGCGACAAGAACTACATTGTGCGCGCGCTCGAGTTCTCACCGGACTCATCCAAGCTCGCAGTGGC
GCAGAGCGACAACATCGTGTTCGTGTACAAAATCGGACTCGAATGGGGCGACAAGAAGAGCATCTGCAACAAGTTCGCGCAGCCCAGCTCCGTGACGACG
CTCACGTGGCCAAGTACACACCCGAACGAGATCGTCTTCGGTCTCGCAGACGGCAAGGTCAAGATTGGTCAGTTGCGCAGCAACAAACCAGCCACACTCT
ACGCGTCCGGGTCCTATGTGTCCCGGGTGTGTAGCAACCCGGAGGGCACCGCTATCTTGTCGGCGCACTACGACGGTGCCATTTATCGCTTCATCTTTGA
CGATGTGACAGGAGGCCCCACGCACGCTAAGCTTGTGGTGCACTCGTGCGTGCCCTACGCGCTCTCGTGGGGCGAAAGCATCGTAGCTGCGGGAAACGAT
CGCGCGTGTCATTCTACGACAAGGATGGTGCTCAACTACGCACGTTCGACTACTCCGGAGACGAAAAGTGCGGTGAGTTCACTTGCAGCGTGTTTAATCC
GACAGGCGAGTCTGTGGTCGTGGGTAACTTTGACTCGTTCTACACCTTCAACTTTCAGCATAAAACTGAATCTTGGGAGCTCGTGGGGAGTAAAAGTATT
CCTAATCTCTACTCGGTCACTGCCCTTGCATGGAAACATGACGGCAGCCGTCTAGCGGTAGGCTCTGTGTGTGGGGCTTTGGATCTGTACGATGCCTGCG
TGCGCCGCTACCGCTATAAAGGCAAGTTCGAGTTCACGTACGTGTCGTTGAGCCAAGTGATTGTCAAGCGACTCGCTACAGGAGCACGAGTTGTTGTACG
CTCTGCATTTGGCTGCGAAATTACCAAGCTAAACGTGTTCCAAGATCGGTTCCTCGTGGGTAACACGACCAATACGATTCTCGTCGGAGATCTCGACACG
TCACGAATTAGTGAGGTGCAGTGGCAGTCCACAGGCGCGGAGAAGTACATGCTGGACAATGAGAGCGTCTGCGTTGTGTACCAGGCGGGTGAACTGTCAC
TGATCGAGTATGGACAAAACGAGTTGCTGGGGTCTGTGAGGACGGAGCACCTCAACACGCATTTGCTCAGCGTGCGCATTAACGAGCGGCCCCCACTCCC
CATGCCGCAGGATGGTGGTGATCCGACACAGCCCCAGGAGAACAAGAAAATTGCATACCTACTGGACCTGCAGACTATCTGCATCACGGATCTTCACGCT
CGTGCTGCCTCCACTGTCAACCATGATTCCCGTGTAGACTGGTTGGAGCTCAACTCGCGCGGAAATTTGCTTCTGTTCCGCGACAAGAGACGGCAGCTTC
ACCTCTTTGATCTCGATACGCAAAAGCGAAGCACCCTGCTCAACTACTGCAACTACGTGCAGTGGGTGCCTGAATCGGATGTGGTTGTAGCGCAGAATCG
TGGAAACCTATCGGTCTGGTATAATATTCGTTCGCCTGACAAAGCTACCATCTACCAGATCAAAGGTGACGTGGAGCAGATTGAGCGCGGCAATGGGCGC
ACTGAGGTGATTGTGGATGAAGGCATGAATACGGCCTCCTATCAGCTGGATGAGTCCTTGATTGCCTTCGGTGCTGCTGTAGATGACGGGCAGCTCGTGA
ACGCGATGTCCATTCTTGAACCTCTCGAGCTCACGCCTGAGACTGAGGCTATGTGGAGTCAATTGAGCCTGGAAGCTTTAACGCAGAATGACCACCGCAT
TGCCGAACGGTGCGCCGCAGCTTTAGGAGATGTCGCTCGCTCCAGATACTTG