Description :
From Genome Similarity Track
Location :
Scaffold_109:51754- 54656
Sequence
2902 bases(100 bases per row)
ACACTTCGGTAACATGGGGTCGCCGCTTCGATCAAATGACGGTCAAGTCCCTCGCCAAACACTTAGTTTTGGGGAAACGCTCAATTTTGTCCCCAGCAGC
CAGCGTGGAGCACCGGTACTGTCTTCTCGTCACAATATCTACTCGTCCAGAAGGAACATTTTCTCGTCGAGCCGCAACAACACGTTATCGTCGGCAGGGT
CTTCATCGAGTGGTACTGCTGGGGCTGGATCAAATGTGGTAGTGGTCCAGAATCCAGAAGTGCTTCTTCGGCAATACCGGCAATTTCTCGAGGCGGCGTG
TGGCGCTCTGAAGATGGGGATTGATCAGTATGATGACCCCGTATTCTTGCGACTCCGTTACCGATGCCGCAATATTTTCTTGCAGGAGCTGATGAGTCAT
TTGGTGGGCAACTTTGAGGAATTCAAGCGTGTGTACAGCGTTGACTGCTGTCAGTTCAGTGGCTTTATTGGCACTGCAGATGGCCAACGAGAAAAGACCA
ATTTTTATCTAACGCCCCGTGCTCTGATTGCTGTCCAAGTAGTGGGGCGTCATACGCGTGAAATTGAGTACCGCACGATTGAGGAGGTCACTCGAGCAAC
AACAATACCAGACGCGTTCATACTCACGGCAAAAAAGAAGCTGAAGTTCATCTACTCCGATCAAAGCAGCGATATCGTGGAGAAAATGAGGGCTCTGGCT
GGAGTTATTGGCATCCACCTTCGGTTTACAACACGAGACAAGCTTCCAAAACAGCATGTCGAAACGCCAATGGATCACTCCGCTTTTCAGTCAAACGATT
TGTTTGATGTTCAAAGACGGACGGGCAGGCACGGATCAACGCGTTTGCGAAAGAAAAAACTTTGCTTCGTTGATGGCACCATTGAAGAGTTCTCAAATTC
TTCAAAGAAGATATACGATCTGAAGGATTTGCGACGTGTAGTGATACCAGGACTGGGGAGTGACGATACTCAAGCGATGGTTGCATTGGAGTTTTCAGAC
TGTAGTCGCGTCGTGTATGTGCCTTACGACGTGGAAAAGTTTTTGGCGGCACTATACGACGGATATCGCTACGTGGATAACTTGGATGTTTCGTTGAGCA
GAGAGTTCCCAAAATTGAACCCAAGAATGTCCGCTCGGGCTCTGCTGAAGGATGAACATGAGCGCTTTCTCTACCTAAACAGTGACGGACTGTACATTCC
CACTCACACGGTCCTGGAAAAGGAGATTGAAACCATGACTGGGGAAGGCGTGAGTATCACATCGGCCACAAATCGGGTTACTTTTGCTCTGGAAAGCTTG
AACATGAACGTTGAAATGGAGGATTTCGCGGGGAAATTAATGCGTGGGCGTTTGGAAAAGCTGTCGTACGGCTCCCTCCTCCGCGGATTGAATAATCTGG
TACGTTGTACGTAGGTATTTGAAATCTCGTGATATGTATTGTCATTCCTAACGTGTTGTTATCTGGGCTGCAGCTCGAGCATTCGTGCAAGCCTCCGATT
CGGGCAAACGAGATCTGTGTCATTTTGGAAGCTTTTTGTCGTATAAATGACGGGTGCTACCGAATTGCGATGGAACAGTCGAACGGTGGTGCTATGGTTC
TGGTTCCAACGCTGGCTCAGATACTTGTATCGGGGGACCCTATCGCAACAGTGTGGGCTGTTAACGCGTTGCATTCACTGGTTGCCGATAAATCACGATC
AAATGCTCACCGTTCTGCCGAGAAAGCTATTCGATATCAAGTCTTCGAGCACAAAAAGCTGATTTCACTACTGACTGACCTTCTGGAGCAACGCAACCCA
AGCTCTACGCTTGTCGTGCTGCAATTGGTACTTGATGTGCTGGTCGTATCTCGCCACAGCACCGATAACAATCACTTCGATGCCATCGTGAAGGCTTTGG
GAGGGAAATATGCACTACTACTGGAGCTTGCGTCGCAAAATATGATCGCAGGGTTGTCTGCGGCTGTTATTTGTGTCTTAAAGGTGATTGTTGATCACGG
CGATCACAAAGTTCGACGACGCATTTGTGATCTGGCTCTGGATTCTGGGCTGACTATAAAGCATCTGCACAAGGCGTTTTTTCACCCTTCCGATAATGCA
AAGGAGACCTATCAATACATTGCAAGTATCTGGGTAACTCATCACAAGGCCTCTCATGAAATGCTAGTGAGGATCCTTCCCCATGGTTTCATTCGAATGA
TTTCGAGTCCGATGGTACGGAAATTGTTGAAAAAGCAACGAGCTCGGCAAACGGAGTCTGTGCGGCGGCAAACCCGGCTTCAGCTCCAGAAACAGGTCGA
TGGTTCAGAATGGTTCATTCGTCGCATGCAGCTCCAAATCGGAACACTGTTTGCTAGTGGTTCTGTCAAAGAAGCTCGAGTCAAGGAAGATGCTTCGCGT
ATGAATTATCCTGGTGAGTCATCGACAGATATGGCTCTTCTATCCAGTATGGTCGGTAAGGATTTTTTGCTGCCCGACTTGATTTGGAACGAAGTGACGC
GAGCTGAATTAAAGACTGCTCTTAAATCGGCGATTGACGAGTTCGACCAATTTAAAACTAACCAAGCAGCTGCGTTCTCCTTGGCGGTATCTCGAAAAGG
AAGCAGTGAACCTAAGTGGAATCACGCGCAGTTTTCTGTGAGGTACGAGAGCATTGCTCAAGAGCTTCAAGTTGACCGATTCTACCTGCGCGTTATCACG
GAAAGGATAAACGATGGATCGTTGCAGTTGACGGAAGTTGCCCAAACTGTCCGTTCAATCGATGCAGGAACACATCGTGGAAAGCTGAAAAATTCTAGCA
GCCTCTTTTTTGCCAGCATGGATATTGCCAAGGACCCAGCGAAGTTTTTTAGCGAGGTCTATCAGTGTTGGCTGGAGCATCTCCACCTGAATAATATCCC
GC