Description :
From Genome Similarity Track
Location :
contig_27:517530- 518968
Transcript NameFunction/comments
g7044.t1hypothetical protein

Sequence
1438 bases(100 bases per row)
GCGCTGCAACCACGGCCTGGACAACATGATCGAGCTCAACCACCTGCACGAAGCGGCGATTTTACGAAACCTCAAGAAGCGCTTCCGGGCACGGATGCCG
TACACGTACACGGGGGATATTTGTCTGGCCGTGAACCCGTACCAGTGGCTGGACGAGCAGTACAAGCCCGGACTTCACCAGAAGTACATGCGGGCACGAA
AGCGGCAGGAGCTACCGCCGCACGTGTACGCTGTTTCGGTCGCAGCTTACAGGCATATGTGTGACGTCGGCAGCAACCAGAGTATCCTTGTGAGCGGCGA
GTCCGGCGCTGGAAAGACCGAGACCACCAAAATTCTGATGGACAACCTGGCCACGATCGCGCCAGCTCCAAGCAGCTCACCAAGTGAGCAGGAAAACAGC
ATCACCACGCGTATTATCGAGGTAAACCCGCTACTCGAGAGCTTCGGCAACGCCAAGACCACTCGCAACGACAACTCGAGTCGCTTCGGCAAGTTCACTC
AGCTCCAGTTCGACAAGAATCACGCGCTTTGCGGCGCTCAGTGCGAGACGTATCTGCTAGAGAAGACGCGCGTCATCTCACACGAACGCGGTGAGCGGAA
CTACCATATTTTCTACCAGCTCTTGCATGGCCCCACGCCAGATGAGCGCGACGCGTTGGGTCTGGGAGACGAGAGCCCGAAGTTCTCGTATCTGCAGGAG
AAGGAGCCACAGCAGGAGACGAGACCAGGACGAAAGCCCAAGCCATGCGCGCCACCGCCGCCCAAGCCAGCAGCTGTGGTAGAAGCTGAGAACGCCAAGG
ACAAAGCTCTCTTTGCGAAGACAAAGCAGGCGCTTTCGTTGCTCGGACTCGGCCCAGCACAGCAAAACGACCTGTTCCAGGTCCTGTCGGGCATTCTGCA
CTTGGGCGAGGCTCAGTTCTCTGCAAAACCCGACAATGATGAAGCGTGTGACCTGGACAAGGACTCGGTTACCTATTCGAGCACGCTGCTCGGTCTGGAC
CCAGAGACCATGGCCAAGGCTCTCACCCACCGCACTATGAAAGCTGCTGGAGAGGTATATCTGGTCCCACTGACGATGGAGCAGGCTCAAACTGGGCGTG
ATGCACTCGCTAAGGCTATCTATGCGAGCATCTTCGACTGGTTGGTGGCAGGGATCAACGCCAGTCTTGGTGCGGCACCACGCCTTACTGCGAGCACGAT
CGGGGTGCTGGATATCTTCGGCTTCGAGAGCTTCGAGTACAATTCGTTCGAGCAGCTCTGCATCAACTACGCAAACGAAAAGCTGCAGCAGAAGTTCACC
CAGGACGTGTTCAAGGCCGTGCAGGAAGAATATGAGCGCGAGCAGATCACGTGGGCGCACATTGCGTACGCTGACAACAGCGATACTCTTGCACTCATCG
AAGGTCGTATGGGTGTGCTCGCTCTGCTGAACGAGGAA