Description :
From Genome Similarity Track
Location :
contig_27:517497- 518935
Transcript NameFunction/comments
g7383.t1hypothetical protein

Sequence
1438 bases(100 bases per row)
GCGCTGCGACCACGGCCTGGACAACATGATCGAGCTCAACCACCTGCACGAAGCGGCGATTTTACGAAACCTCAAGAAGCGCTTCCGGGCACGGATGCCG
TACACGTACACGGGGGATATTTGTCTGGCCGTGAACCCGTACCAGTGGCTGGACGAGCAGTACAAGCCCGGACTTCACCAGAAGTACATGCGGGCACGAA
AGCGGCAGGAGCTACCGCCGCACGTGTACGCTGTTTCGGTCGCAGCTTACAGGCATATGTGCGATGTCGGCAGCAACCAGAGTATCCTTGTGAGCGGCGA
GTCCGGCGCTGGAAAGACCGAGACCACCAAAATTCTGATGGACAACCTGGCCACGATCGCGCCAGCTCCGAGCAGCTCACCAAGTGAGCAGGAAAACAGC
ATCACCACGCGTATTATCGAGGTAAACCCGCTACTCGAGAGCTTCGGCAACGCCAAGACCACTCGCAACGACAACTCGAGTCGCTTCGGCAAGTTCACTC
AGCTCCAGTTCGACAAGAATCACGCGCTTTGCGGCGCTCAGTGCGAGACATATCTGCTAGAGAAGACGCGCGTCATCTCACACGAACGCGGTGAGCGGAA
CTACCATATTTTCTACCAGCTCTTGCATGGCCCCACGCCAGATGAGCGCGACGCGTTGGGTCTGGGAGACGAGAGCCCGAAGTTCTCGTATCTGCAGGAG
AAGGAGCCACAGCAGGAGACGAGACCAGGACGAAAGCCCAAGCCATGCGCGCCACCGCCGCCCAAGCCAGCAGCTGTGGTAGAAGCTGAGAACGCCAAGG
ACAAAGCTCTCTTTGCGAAGACAAAGCAGGCGCTTTCGTTGCTCGGACTCGGCCCAGCACAGCAAAACGACCTGTTCCAGGTCCTGTCGGGCATTCTGCA
CTTGGGCGAGGCTCAGTTCTCTGCAAAACCCGACAATGATGAAGCGTGTGACCTGGACAAGGACTCGGTTACCTATTCGAGCACGCTGCTCGGTCTGGAC
CCAGAGACCATGGCCAAGGCTCTCACCCACCGCACTATGAAAGCTGCTGGAGAGGTATATCTGGTCCCACTGACGATGGAGCAGGCTCAAACTGGGCGTG
ATGCACTCGCTAAGGCTATCTATGCGAGCATCTTCGACTGGTTGGTGGCAGGTATCAACGCCAGTCTTGGTGCGGCACCACGCCGTACTGCGAGCACGAT
CGGGGTGCTGGATATCTTCGGCTTCGAGAGCTTCGAGTACAATTCGTTCGAGCAGCTCTGCATCAACTACGCAAACGAAAAGCTGCAGCAGAAGTTCACC
CAGGACGTGTTCAAGGCCGTGCAGGAAGAATATGAGCGCGAGCAGATCACGTGGGCGCACATTGCGTACGCTGACAACAGCGATACTCTTGCACTCATCG
AAGGTCGTATGGGTGTGCTCGCTCTGCTGAACGAGGAA