Description :
From Genome Similarity Track
Location :
scaffold_3:517458- 518639
Transcript NameFunction/comments
Plaha_PHALS_12755transmembrane protein

Sequence
1181 bases(100 bases per row)
TCTAGTAGATGCAAAAAATTGGCCTGAAGGTGCGTCGACTTTTTAAGGACTAGCTCTGTCTGTGCTAATTGCTCTTTTGCGCTCCGTAATTCCTCAGTTA
AAGCATTAAACCGCTGTTGGTCAAACTTGGCCTTGATCATGTGCTTTTGTAAGCGGCGCGTATACACGTAGTGATAGATATTTTCATATTCGTATTCCTG
ATTCGTGATGCTCCACCAAGCGTAACCAATAATTGAGACACCAAAGCCTGTAAAATACGTCACTGGTTCCATGATATCCCATGAAAAATGAATAAATGAC
AACCAAAAATAAAGTCCAAAAGCACCGACAAGTGAGGTTGAAAGTCCGTACGAAATGCGGTTAGCTTGTCGCATTGCTGTTGTTTCGAGTTCGCGACGAA
GATTCGCTAGTGCTACATGCTCGGGTTCTAGTGCTTGGATTTTTAACAATAATGTTGCTCGCTGTTGCTGAAAAAGCTGTGAAGACAACGGTAACAACCC
AATCGATTCTAGATACGAATCGAGAATACTGCGTGGTTGTAAGAAAACAGAATGGGTTAAATCTTCCTCGTCCGATTTACCAAAGTAAAAGAGTAGTCCA
GATTGATGAAAAGCTTGGAGAACTTCTGGTGCTTGTTTTTTTGGAATGCCGCGCTCCCGACACATGGTAATAAAGTCTGGATAACTTATTTTCCACTTAC
CGAGACGTTCTAAATCACTGCGTAGCAAGATAATGGCACTTTTCTGAGCGACAGACCGCACATCAAGATCGCCATCATCTGCTAAACTCTGGTACGCACT
GCCAGTAAAAACTGGAGCTCGAACCGGTAGAACTTGGTCGTTAAGTAAGAGCTCAAAGTCGTCAGTTAGAACATTTTGCAATGTATCTTCAGGCTGAAAC
TCTTCACCTCTCGTCGATCGAATGGTTACACTTTGGATTGACTTGTCTTCAGCTTCGATCTGGGTGATGATATCGGCTACAGTGGTTTCTATTTAGTCGA
CCGCACTGCAAGTTAATATCTTATTTATTATATTAGCAGAAATAATACAATAATACCTGGAGGGATACTGAACACGCGCTCTTCGTCGAATCCGTTAAGT
GGTAGTGGAACTGCTAGCGTGCATGTTCCGTTGTGGTATTTGAGTTCGATGGCACGAGCTTTTCCGTACTGAAGTGGAGAG