Description :
From Genome Similarity Track
Location :
contig_28:517438- 519130
Transcript NameFunction/comments
g5663.t1transmembrane protein, putative

Sequence
1692 bases(100 bases per row)
CCCAACGCGAGTCGAATCTATCGACGCCTCGGCTTAGCAAGAAGCTGCAGGTTGAAGATGGTGGCGACTATCTCGAGGCCAAGTCACCCAACCTGATGGC
CAAGGTCGAGGAGGGCGCCCTGCGTGAAGGTCCGCCGCCGGATTCTCGCAGCAAGACCTACTTCGGCTTCCTGTTCCAGTACGCAGGCGCTGGCCTGATC
TACAGCGTGCTGTACAGTCTCACGTACCCGTTCCTGAACAACTACCTGCGCATGTCGGGCATTGCGACGGCTTCCGCCAGCGTGCTGATCGCGCTGCCTT
GGTCACTCAAGACCTTCTTCGGTATCATCACGGATTGCTACCCGATCTTCGGCTACCGCCGTCGCCCGTACATGGTCATTGGCTGGGCAGTGTGCACGGT
TTGCTCGTTCGTCATGGCTGTGCTGCCTGAGGGCGACCCGTACTACCCGGACAACGCATGGGCGTCGCTCACTGAGTCGGAGCTCACTGCGGAGCAACTC
GCGGAGATCAACTACGGGCGCCCCCGACGCCGGCATCAAGTTCATCCTGCTCATGATCGTCGCCAATTTGGGCATGGTGCTGTCCTTCACGGCTGGGTGG
CACACTTGTCGAGCTCTCGCAGCGTGAAGGAGAGAAGAGGCGCGGCGACTTGCAAACCATGATCTGGGTCGCTCGTGACGTTGGCGGTGTCGTCGCTTTA
GCTCTTGTCGGATTCGGTCTCAACTCGGAGGAGTACGGCGGCACCTTCTCGGGCTCCATCCGCGTGGGAGGCCTCATGGGCATCTGCGCCGTCACCTCGT
TCGTCACCGGCGCGGTGGCGTGGTTCTGCATTGATGAAGAGCGCGTGGAGCGTCGTTCCATGAGGGTGGAGGTCGGCAAGTTGTTCGACCTGATCCAATA
CCGCGTCGTGTACCAAGTGCTGGCCTACCAGTTCTTCGGCAACATGTTCGCCTACGTGAGTGTGACGGCTGCGACCCCGCTGCAGAGCGTTTGGCTGACC
ATTACGCCCGTGAACAGCAGCGTCGCGTCCATCATCTCGACCTTTATCTCGATTGCGTCGCTTCTGGCAGTTCGTCAGTGGGGGCTCAACTGGAACTGGC
GCTGGATGATCGTGGTCACGGAGCTTGCTGTCGTGTTCGTGGACTGCTTCCCGACGTTCCTCACGATTTGGGACGTCGTCCGTAGTCAGTGGTTCTGGCT
GGGCGTGCCGCTTCTGGAGCAGGTGCCCACCAACATCGGCTTCATTGTGTCCACCTACTGCATGGTCGAGATCATGGAGGAGGGCAACGAAGCCGCTTTC
TACGGTCTCGTCGTCGCTGTGTCGAGTCTGGCGTCGCCGTTCGCCACGGTCATCACCAAGAACATCGACGCCAACTTCGACATTGCCACGGCCGATCTCC
AGCGTGACGACACCGAAGTCCGCCAGCAGGTCACGTACGCGTACCTGTGCTCGTACGCGTGCAAGATCTTCTCGACGATCTTCGTGCTGCTCATCCCGCG
CCAAAAGGCCGAGACGCAGGAGATGCGTCGCAACGGCGGTAAGAGTAAACTCGTGGGCATCCTCGTGGTCATCATCATCGCCTTCACGTACGTGTGGACG
ATCATGACCAACATCATGTCCATCTTCCCGTCCACCTCCTGCCTTAAGATCGCTGGCGGTGACGGTTGCTAGACTACTGCAAACTACTTCTG