Description :
From Genome Similarity Track
Location :
Scaffold_16:517366- 518652
Transcript NameFunction/comments
Physo_131564pol protein

Sequence
1286 bases(100 bases per row)
TGCATCAAGGCGCATCCGATCGCGAAGTCGCTCGCGTCGCACACAACATGGAAGAGCTTCAAGTGGTCTGAAACCATGAGCACGGGTGCGGTGGACAAGC
TCGACTTCACCGCGTCGAAGGCAGCTTGTTGCTCGGGACGCCACGACCACGTGGCGTCTGCCTTGAGTAGTTGAGATAGCGGGCGGATCGTCGAAGCGAA
GTTCTTCGAGTAATGGTGAAGATACGTGGCGAGCCCCAGCCACTGCCGGAGCTGCTTCTGGTCCTGCGGCGTCGGCCACGCGCAGATGGCCTCGATCTTC
TCGGGGTCGGCGCGGACACCGTCCTTGCGGACGTAGCTCCCAAGCACAGGGATCTCGGGAGCGCAGAAGATGCACTTCTTCAAGTTGGCGTACAGCTTGT
TCTCCTTCATCACCTCGAACACCTTGCGCAGATGTAGTAGGTGGACCTTAACGTCCGTCATGCCGTCCTCGGCACGACTGTGAATGAAGATGTCGTCGAA
GTAGCTGGGCGCGAAGTCTCGATACGGCCGAAGCAAGTTGGACAACATCCGGTTGAAGGTGGCGGGGGCGTTCTTGAGCCCCTGCGGCATCACGAGCCAT
TCTCACAACATCCCGCTGGGCGTGCTGACCGCTGTCAGCGGCACATTGTCTTCGCGCTTCAAGATCTGATAGAAGCCATCCATCAGATCAATGGCACAGT
ACTTCGTGCTGCCAGACATGGTGTCCAGCACCATGTCCTTCCTCGGCATCGGCGTTTGCGCCGGTATGGTGGCCTCGTTGAGCTTGTTGAAGGCGTTGAC
GATTCTCCAGCCGCCGGTTGCTTTCTTCACGCAGAACGTCGGACTGGAGTGCGGCAAGAGACTCTCGCGGAAGTGGCCGGCTTGCCGGCGACTCTCGAAG
AAGGCGTCAATGGCTTCGACTTGGTCGCGAGGAAGCGGCCACTGCCGCGTCACGCAGTACTTCGCACCGGACTCGAGGTCAATCTCGTGCCGAACACCAC
GGTCGGGTAGAAGAACGGCTGGAACCTTGTCCGGGAAAATCTTCATGAACTCGCGCACGAGCGGAGCGACTTGGTTGCCGGCCGCTTCGAGCGCCGGCAA
CGACTGAGCTGCGTAGCGGGCTTGACGGGCGTTCTTCGGCTCGGCTCTTTTTGGGCGCGTCCTAGCGTCGGAAGCTGGGTCCGATGCACTGGTTGCGACG
GCCGTAATTGACTCGGCGTCTTCGGCGACGATCATGCACACCTGCTCGATCTCGCCCTGCTCCAGGTCACGGAGGAAGTGTTTCCA