Description :
From Genome Similarity Track
Location :
Scaffold_164:51733- 52757
Transcript NameFunction/comments
g8642.t1POM76336.1 Hypothetical protein PHPALM_6433 [Phytophthora palmivora var. palmivora

Sequence
1024 bases(100 bases per row)
TTCGTGGCAATCGGCCCCGTAATGCGTGGGGGGCGATGGTGATCGGCACGGTGGTGGGGCTGGCTGGTTTGAGTTATGCAGCCACGATGCACCACTCTCT
GGCAGTTCAACAGGAGATCGTCGCCAAGATGCAGCAGCAACTGTGAGGACACTCTGGAACATGCTTTATCGGTCCTCGTCGAGTACTCAGTGTGCGGTGT
CTTGTAGGGATGCGATGCACTCGGCTATCGTGGCGGAGGAAGACACGACCTGGGACAGCAAGAAGCAGTTCAAGAAGGCCAAGAAGTTCCCGACCAAGTT
TGCAGTCGACTACGTCACTCCGCTGAAGACGCAGGACGAGCGCGGAACGTGTTGGGACTTCGCTACGGTCGGCGTCCTGGAGAACAGCTATCGCCAGCAG
GGAATCGCTCATGGCTGGCTGCAGGAAGACGAGTACATGGCGATCTCCGAGCAAGCGTACGGCGCCGAGGTGCTGCGTCTCTGTGCCGGACCTCCTGATT
CACCGCAACAAGTGGCGTGCTTACTCCCAGGCAACGGCATCTGGGAGAACTCGACAGAGGGCGGTGACGCCACGCTGCTGATGTACCTGGTGAACGGATT
GAAGGACAATATTTACCCCCATTCGATCTGTCCATACTACCCTGACGACGGCAATGACACCGTGTGCGCCGCTTTGACGCCCGAGAAGCGCCGACTCAAC
CCGCTGAGTCTCAAGCTCATGAAGATGGACACCCTGTTTGAGGAGATGTCGATCAAGCGCGCAATGGTGAAGCACCGCCAAGCCATGTCCTTGACGACAG
CAACACCCTACACTACACACTACTACCCCTGCATCGGAGAGCTTGCTAGCGAAGATCAGTGCAACCCAGCGTCCACCGCGTGTACTCTCTGTCCACCCGA
ATTGTCAATGACAACCTGCTGCATCCCCATCGAATTCGGAGAAAACTACAACATGAACGGCGAGTTTATCACCAGCCACGTCATGACGCCGGAAGGTGGG
CATGTCATGACGCTCGTCGGCTAC