Description :
From Genome Similarity Track
Location :
contig_27:517312- 519711
Transcript NameFunction/comments
g7044.t1hypothetical protein

Sequence
2399 bases(100 bases per row)
GGGGCTCGGTGCTACATTCCGGACGCGGATGCGGCGTGGTTGCCCGTGTACGTGGAGGAGGTGAACGAGCAGAAGCGGCTCGTGACCGTGAGGGTCCAGC
GCCCGCGGAAGGACCAGCAGGACGACGACTCGGCCGACCATGACGACTCGGACAGGAGCGGCGAGCAGCGACTCGTGGCCATCGACGTGGGTTTCCCTCC
ACAGAACCCGCAGCTCTCGCGCTGCAACCACGGCCTGGACAACATGATCGAGCTCAACCACCTGCACGAAGCGGCGATTTTACGAAACCTCAAGAAGCGC
TTCCGGGCACGGATGCCGTACACGTACACGGGGGATATTTGTCTGGCCGTGAACCCGTACCAGTGGCTGGACGAGCAGTACAAGCCCGGACTTCACCAGA
AGTACATGCGGGCACGAAAGCGGCAGGAGCTACCGCCGCACGTGTACGCTGTTTCGGTCGCAGCTTACAGGCATATGTGTGACGTCGGCAGCAACCAGAG
TATCCTTGTGAGCGGCGAGTCCGGCGCTGGAAAGACCGAGACCACCAAAATTCTGATGGACAACCTGGCCACGATCGCGCCAGCTCCAAGCAGCTCACCA
AGTGAGCAGGAAAACAGCATCACCACGCGTATTATCGAGGTAAACCCGCTACTCGAGAGCTTCGGCAACGCCAAGACCACTCGCAACGACAACTCGAGTC
GCTTCGGCAAGTTCACTCAGCTCCAGTTCGACAAGAATCACGCGCTTTGCGGCGCTCAGTGCGAGACGTATCTGCTAGAGAAGACGCGCGTCATCTCACA
CGAACGCGGTGAGCGGAACTACCATATTTTCTACCAGCTCTTGCATGGCCCCACGCCAGATGAGCGCGACGCGTTGGGTCTGGGAGACGAGAGCCCGAAG
TTCTCGTATCTGCAGGAGAAGGAGCCACAGCAGGAGACGAGACCAGGACGAAAGCCCAAGCCATGCGCGCCACCGCCGCCCAAGCCAGCAGCTGTGGTAG
AAGCTGAGAACGCCAAGGACAAAGCTCTCTTTGCGAAGACAAAGCAGGCGCTTTCGTTGCTCGGACTCGGCCCAGCACAGCAAAACGACCTGTTCCAGGT
CCTGTCGGGCATTCTGCACTTGGGCGAGGCTCAGTTCTCTGCAAAACCCGACAATGATGAAGCGTGTGACCTGGACAAGGACTCGGTTACCTATTCGAGC
ACGCTGCTCGGTCTGGACCCAGAGACCATGGCCAAGGCTCTCACCCACCGCACTATGAAAGCTGCTGGAGAGGTATATCTGGTCCCACTGACGATGGAGC
AGGCTCAAACTGGGCGTGATGCACTCGCTAAGGCTATCTATGCGAGCATCTTCGACTGGTTGGTGGCAGGGATCAACGCCAGTCTTGGTGCGGCACCACG
CCTTACTGCGAGCACGATCGGGGTGCTGGATATCTTCGGCTTCGAGAGCTTCGAGTACAATTCGTTCGAGCAGCTCTGCATCAACTACGCAAACGAAAAG
CTGCAGCAGAAGTTCACCCAGGACGTGTTCAAGGCCGTGCAGGAAGAATATGAGCGCGAGCAGATCACGTGGGCGCACATTGCGTACGCTGACAACAGCG
ATACTCTTGCACTCATCGAAGGTCGTATGGGTGTGCTCGCTCTGCTGAACGAGGAAATCGTGCGCCCTCGAGGCAACGAGGAAGGGTTCGTAAGCAAGCT
GTCAGGTGCCTACCTCAAGCAGAAGAAACTCATCGAGTTCCCACGGATCTCCAAGACCCAGTTCGCCATCCACCACTACGCCGGAACGGTGAAGTACGAG
GCCACGGGGTTCCTGGAAAAGCACAAGGACGCACTGCTGTCGGACCTGTCCGATCTCATGTGCGGCAGCCACGAGCCGTTCCCGCAAATGCTCTTCAAGG
TGAGGGCTGAGATGGAGGCTGCATCTGCTATGAGCTTGTCCCGCTCGACTTCAGGGAGCCGGAAGGCGGGTAGTGCTCGCAGTGCGGGATCCGACAAGAC
GGTGGGCATGCAATTCAAGCAGTCTCTGAACTCCCTCATGACCAACATCAACGAGACCAACGTCAACTACATCCGCTGTATCAAGCCGAACAGCGTCAAG
AGCGCCACACTGATCGAAGACAAGATGGTCGCCAACCAGCTACGCTGCGCCGGTGTCATCGAGGCCATTTGCATTGCTCGTGCTGGGTACCCGAACCGAC
TGCTGCATGCTGAGTTCGCAGAGCAGTTTGACATCTTCCTCTCCGAGCAGCAGCAGAACCAGTTGCAGGAGGACGCAGCAAAGTATGGAGCGCCTCATTG
CCGAGTCTTAGTGAAGCAGTTCAAGCTCGTGATGCCCGAGGAGTATCAGATGGGCGTGACGAAGATCTACCTGCAGAAGGGTGTGCTTGAAAAGCTCGA