Description :
From Genome Similarity Track
Location :
Scaffold_1054:5173- 8771
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1054-snap-gene-0.5FtsJ methyltransferase domain-containing protein
Pytul_var.sporangiiferummaker-pug3_contig_1054-snap-gene-0.6Conserved gene of unknown function

Sequence
3598 bases(100 bases per row)
GATCATCTTCCAATGCACAAGATTGTTAGTGCGTTAGAAGCTCGCCTAGAGAGCCCGGAGAAACGCATGAAGCTTCTCTTCGATCCAAATATCCTTCGCG
GTGACGCAATTTTCCTTCAATATATGGCCGTTGTAAGCGACAGAATGGCAGCCAGCCAGATTCGGGCATGCAGAGCAATTCACGACAGAGCCAACAGCAA
ACGCAAACGGTAAGCAAACAGCATTTAACACTTGGCCTGGAATATGTAAGCTCTGATACTCACATAGCGACGTGTTGGTTGGCACTCGAATAACAGGCAC
TCACACGATGACAACTGGGTTGATCCCACTCGGTATTCGCAATGCTGGGGTCTTGAGGATGCGAACTTCACAAACCAAGGGTGATCTCTCCAAACTTGAT
CGGACCCAATGTCCCCACAAAATGTCGCGACGTCAATGTCCCCGTACTGCTGGAAAACCTGCCTTATATCGTGTTGGATGCCCTCAAATTCGTCGAAATC
TTGTAACTCGTCCGGCTCCAACTTATCCTCACTTCGATATTTGAACACCATGCTGTACAGCGATATTTTCCAAGGAAAGAGTGCCTCTAGCCATCCATGC
ACAGAGCTGGTAACGACTACAATTCTACGTTGGCTGTAGCGCGCAGTGGAGAAGAAAGCGTCTCCCATCGTTACAAGACGATCGTATGTGCATAAAAAAT
CAATGTTTACCTTCCGTTACCTGTTTGTGGTTTATCGGCAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCATGTTCACATTCTCCGCCAGA
CTGGGACGCCTGCTTGGTCTCAACGTGCGCGCCCTCGTAAATAAATGGCATGACTTCATTTCGTCGAGAAACGCACGAAGATTGCATCGACTCAACTGCT
TAGGACGAAGTCAACGAACATACTACGGACTTCCCATTCTGCAGCCATCTTCCAAGAAAGCTCATCCTACACCGAGTGTTTTATCTCGCGACGGCGAGAA
GATGGACTTCCTCGGAAGCATCGTCAAAGCGACCGGTCTCCATGCATTCAAGCAGTACCGACGCGCAAACACATTTGTGAATTTGCATAGTGGAAAGCGA
CTTGTCGCGTGCAGCCTGACCACTGGATCATGGAGGCGCTGTGCCAGTATAAGCGACACGAGCATCAAGGTCTCGCAACCCAAGCCCATCGCGCAACCAA
AAAGTCTATCGAAGAGATCAAGGCGATGTATCTCAGCCCCTCCTCGCAAAGAGCAAGCATGAACCGCTCCGATCTTTGAGTGATATGCAGCGGATGTTGC
ATGTTTTGCTTGTCACCGCAAGTGTCTTCAGCGAGCTCCTGCGAGAGTATGAACCGCTTCTGGTGGAAGTCGCTTTGGTGCATTGCTTGCGTGCAAGGTC
GCACGAACAGCGCAGCAACACCGACATTGCTGGCTTTGAAGCATTTTTTCGGAACGAGCTCCAAGACGAACAGGCTTACATCTGATTCAACTGCCAATTC
TTCATTGATTCCATTGACCTACTCGCGTTGTCACCGTTCTTCTACAAGACACGCATCACAAACCAGCAAGTAAAGGACCTCATCTCGAGGTGCGTCGTCG
AAGGCCGCAACGATTACGACCGTTGCGCCTGNNNNNNNNNNNNNNNNNNNCTGATCATCGCGCGGATGGCGAAAGAAAAAAATAAGGCTGCTTTTGATGG
CTGGATGGTGTGGGTCAGGGAAGAACTGGCCTCGATCGGCTCCCCTCGGCGTGCCACAAGCGAGTATAACCTGTATTTCTTGAGTGACTTGCTGTTGAAC
CCGATCCATCTGCACCCAGACAAACAAGGCTATTTCCCTATCGCAGTGGGCATTAAAGGCTTCGGTTCGCATGAGTTCTACGACCATTGCGGAGTGATCA
TCAACGAGAAGGGCCACGAGAATACGTATGGCCCCGGATTCTTTTACCACGGCACCAAGCAAAAGATCTAGCTACTGAGCTCTGCATAACACCTCAAGCG
CACAAGCGCATGCATATACCGTTCCAAATGCATACACATATTCTTTTCTTTTTTCCTTTTTATTAAAGTGCATCATTGGTGACTTTAATGGAATGGCGCA
TTGATTGTGGCCGACTGAGCACTTCTCTCAGAGCTCTTCGGAGTGCAGCCATGTCGGCAACTTCCGTTGCAAAACATCTAACATTAACAACGCCGACGAT
GCTGCGAATTCGTATTACGTCTGCATCAATGCTTTGAGAAAACCACAATCGTCAAGTCAATCGGAAGCGGTCGCCCAGCAAGCTCAGAGTGCTACCTCAT
GCCTGTGAATCTTCGTGACCGTTTTCAGTGGACAACATTGTTGGCTTTCCAACGCTCGGCATAACCGGGTAATTTATCATCATGGAAACAAATTAAGCAA
ATCTGAGGATGTCCTGGAACAGATCGTTTGCGCCCTCCATGGAATATACTCCGACACAGCTCACGCACACGCTCTTGCTTAAGACACGACCTAACTTTCG
CCTAACGAAAGAAAAACAAACGAAAATGTTGAGTAAGTGAGCTACACAACCAAACAGTATGCACCACCTCATACCTGCTCATTGGGTAGATAATTGGAAC
CTCTTGCTTTGATGCTATGGCTAGTATTTCATCCAGCTTTTCATCCAGAACGTCGCATTGTTCAATATCTGTGCCAACTATCAGCAGACATATCTTTTTG
GCCAGGACGCCACGCTTCACTTCACGCAGACCAAGGACGAGTCGCCTCGACCGTTTGTCCTGCAATGGGTTCTGATGGTGAGCCCGTTCCTGCAAGCTCC
CAACGAAAATCACAACGAATCATCATTGCCAGCTCTGCAGACAAAAAAAAATGCGAGCATTGTTAGGCAATCTTACCTGAAGGCTCGCAAGCCGCTTGAG
AAACTTTGCAACAATCTCGACTTGCGAAGGTTCCAGTACCTGAAAGTGCAAATAGAGAGAAATTTAGCGACAAGCTTACACTAGGAAAGATCCCATGATT
ATCGCACCGGTAGAACTCGACGAGCTTCGCTTGACTCAGAGCTCAGCACGCTCCTACTCTGCACGCTGTCTTCAACTAAGCGTACCAGCACTTTACGTCC
ACCATAGGTGCTTCCATTCATCTTTTCGAAAACATTCCTTGCTGATTGCTCTGCCTGGTACACGATCGTGACGGATCCGGTTTCTCGGCAAATCGTTATG
AACTCGATGTCCCCATACTGCTGAAAAGTTTGCCGAGTATCGTCTTGAATGTCCTCGAATTCGTCGAAATCTTGCAGTTCGTCCGGTTCCAGCAAATTGT
CGACTTGGATTTTTGCACTACTGGCATCTTTCTCAATCCACTTGCACTCAACCAAGCGCCCACCAAACATCTTTCCTTCGTAGGTATTGAAAGCAGCTAA
TGCAGACGCATGGCTTTGGAATCGAAGGACTACATCACCCACAGTTGCCCGTAATGCTCCTCCGTCAATAGATACTTCTCGGGTATCATCCGTGCCTCGA
AGAATCTGTAGTTGCACCAACTCGCCAAATTGTTCAAAATCGGATGTAGTTTCCGATTTGATTTCTTCGTACTCGTCATCATCCTCAACCTCATCGCT