Description :
From Genome Similarity Track
Location :
Scaffold_20:5173- 6872
Transcript NameFunction/comments
Phymu_g1328pyridoxal biosynthesis lyase pdxS
Phymu_g1329conserved hypothetical protein

Sequence
1699 bases(100 bases per row)
AATCCTGCAAGTTCTCTTGGTTCTCCTGCTTCGCTTGGATCCGGTAATCACATCGATAGGatgaggtacatgtagtaaccTAAAATTCACATTAGacagt
acagtaccggtacatgtgGATGGCCCAGATCAGTGGGCCAGTGGCGGTTACGCTTGAATTTCATTGGCTGCGTGTATGGGCCACCAATAATGGCGGCCCG
GTTGCACATACGTGTTACCATTGCCACTCGTGCCGCCTCTTATCATTCCCAGTTTCGCTTCGCACACCACAAGCTTCGACCAAGAAATGGCTCCCCAGAC
GACCCCCGCTGCCGGCTCGGCCCCCACTGAAGGCACTTTCCTCGTGAAGGCTGGTCTGGCCAAGATGCTCAAGGGCGGCGTCATCATGGACGTCACCAAC
GTTGAGCAGGCCCGTATCGCCGAGGAGGCTGGCGCCGTGGCCGTCATGGCGCTCGAGCGTATCCCCGCCGACATCCGCGTGGACGGCGGTGTGGCCCGCA
TGAGCGACCCGCAGATgatcgacgccatcaagaaggcCGTGACGATCCCCGTCATGGCCAAGGCCCGTATCGGCCACTTCGTGGAGGCTCAGATCCTCGA
GGCCACCGAGATCGACTACATCGACGAGAGCGAGGTGCTGACCATGGCCGACGAGGAGAACCACATCAACAAGCACAAGTTCAAGGTGCCGTTCGTGTGC
GGCTGCCGCAACCTGGGCGAGGCCCTGCGTCGCGTTGCCGAGGGTGCCGCTATGCTGCGCACCAAGGGCGAGGCCGGCACCGGAAACGTCGTCGAGGCCG
TGCGTCACGCCCGCGCCGTGCACCGTGAGATCCGCCGTCTCGGCGccatggacgaggacgagctgttcgtcgccgccaaggagatgcaggctccgtacga
gctggtgaaggaGGTTGCCACCACCGGTAAGCTGCCGGTGGTGAacttcgctgctggtggtgttgCCACCCCggctgatgctgctcttATGATGCAGCTT
GGCATGGACGGTGTGTTCGTTGGCTCGGGCATCTTCAAGAGCGGCGACCCGGCCAAGCGTGCCCGTGCTATGGTGCAGGCCGTGacccacttcaacgacg
ccaagatccTCAAGGAGATCTCCACCGACCTGGGTGAGGCTATGGTCGGCGTGCAGGACCTGAAGGCTGCGGCGGTTAACTTCCGTGACCGTGAGGGTGA
GCTCCACGGCGCCTGGTAAACACTGGCAGTTGCTACCTGTATGCACAGGAGAGCGTTGATCGAGTAGATAGTGCTCCACACTGCCAATATACCGTATTGT
TATTGCCCAAATCTATGATCTCGCGTTGCAGTACCAACTTGTGCCAGAAAAACTACCTGCACACGTTCGCCTCAAATGGCTCGCCGGCATGCTTGATCGT
GCTTTTGATGGCTTGGTACGTCATGAGTACAGCTCCGATGCAGATTGTCGCCCCAATGCACAGTACGATCACGGATTGACGTCCCGTCCGACGTACGAAA
CCCAAGATGACAATCTGCGAGACAGCAGTGACCACCAGTGCTACCGCCGACAGTAGGAGGGCCCAGTCCCACGCGATCATGTTGAACACGGCGAACTTGG
CTGTAGCCGCAGCTGAAGAGTAGAGCACCATGAGAGCAGTTGTGGACGACGCAACTTCAGGCACGATCCCCATCTCGATCATGAGAGGACCCGTCACAA