Description :
From Genome Similarity Track
Location :
Scaffold_1122:5173- 6187
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1122-snap-gene-0.1Folate-Biopterin Transporter (FBT) family

Sequence
1014 bases(100 bases per row)
GCTCCTGGGTTGGGGTATCTGCTTCGTGATGCTATTCATCATGGCCGTGACCCCAGTGGGCGAGCCGTACTTCCTCAACTCAGACGATGCCGACATTGCA
CCAGAAGACTACGCGTTGTACCCTGGCATTGAAGACCGTCTGAACCCGAGCGCCCCCGGCAAAGCTGGCAAGTACGTGTTGCTGATGATGCTCGCCGCGT
TCGGGTACTTGATGGCCGATGNNNNNNNNNNGATCCTCGCGATCTGCTTGGTGCCGGTGTTGCCGATGACGTGGTTCTACATCAAAGAGGAGAAGCGCGA
GCGCCTCGTGTTCACCGAGTACATGTCGGACCTCTGGAAGCTCATCCAAACCCGCGCGATGTATCAGATCATCTTCTACAACTTCTTCAGCGGCATCTTC
TCGAGCTTCTCGTACACGGCGGCGTCGCCTGTACAACGGTACATGGTCGGCGTCGAGNNNNNNNNNNCACGACGCAGTCGACGATCTACGCCACGCGTAC
GCTCTTTGTTGCGATCAGCACGATCCTCACGGGCTTTGCGTTCAACGGCAAGGAGTACGGTGGCAGCTTCGATTTTTCGCTGAGCTTCCCGACGCTCATG
CTCATCCTCGCGATCTGTTTGGTGCCGGTGTTGCCGATCACGTGGTACTACATCAAGGAGGAGAAGCGCGAGCGCCTCGNNNNNNNNNNNNNNNNNNNNN
NNNNNTTTTTCGTACACGGCGTCGTCGCCTGTGCAGCGGTACATGGTCCACGTCGAGCCNNNNNNNNNNAGTGATGTCATCGGGAACCTCGTGTTCTTGG
CCGGTATCACGGTCACGGGCAAGTGGGGGCTCAACTGGAACTGGCGCTGGATCATCGTCGTCACAGGCGTGCTCGTGATCGCCCTGGACGCCATCGTGGC
GTTCATCACGATCTGGGACGTGTTCCGCAGCCAGTNNNNNNNNNNGGGCATCCTCGTGATCGCCGTCGATGCCATCGTGACGTTCATCACGATCTGGGAT
GTGTTCCGCAGCCA