Description :
From Genome Similarity Track
Location :
contig_27:517279- 519678
Transcript NameFunction/comments
g7383.t1hypothetical protein

Sequence
2399 bases(100 bases per row)
GGGGCTCGGTGCTACATTCCGGACGCGGATGCGGCGTGGTTGCCCGTGTATGTGGAGGAGGTGAACGAGCAAAAGCGGCTCGTGACCGTGAGGGTCCAGC
GGCCGCGGAAGGACCAGCAGGACGACGACTCGGCCGACCATGACGACTCGGACAGGAGCGGCGAGCAGCGACTCGTGGCCATCGACGTGGGTTTCCCTCC
ACAGAACCCACAGCTCTCGCGCTGCGACCACGGCCTGGACAACATGATCGAGCTCAACCACCTGCACGAAGCGGCGATTTTACGAAACCTCAAGAAGCGC
TTCCGGGCACGGATGCCGTACACGTACACGGGGGATATTTGTCTGGCCGTGAACCCGTACCAGTGGCTGGACGAGCAGTACAAGCCCGGACTTCACCAGA
AGTACATGCGGGCACGAAAGCGGCAGGAGCTACCGCCGCACGTGTACGCTGTTTCGGTCGCAGCTTACAGGCATATGTGCGATGTCGGCAGCAACCAGAG
TATCCTTGTGAGCGGCGAGTCCGGCGCTGGAAAGACCGAGACCACCAAAATTCTGATGGACAACCTGGCCACGATCGCGCCAGCTCCGAGCAGCTCACCA
AGTGAGCAGGAAAACAGCATCACCACGCGTATTATCGAGGTAAACCCGCTACTCGAGAGCTTCGGCAACGCCAAGACCACTCGCAACGACAACTCGAGTC
GCTTCGGCAAGTTCACTCAGCTCCAGTTCGACAAGAATCACGCGCTTTGCGGCGCTCAGTGCGAGACATATCTGCTAGAGAAGACGCGCGTCATCTCACA
CGAACGCGGTGAGCGGAACTACCATATTTTCTACCAGCTCTTGCATGGCCCCACGCCAGATGAGCGCGACGCGTTGGGTCTGGGAGACGAGAGCCCGAAG
TTCTCGTATCTGCAGGAGAAGGAGCCACAGCAGGAGACGAGACCAGGACGAAAGCCCAAGCCATGCGCGCCACCGCCGCCCAAGCCAGCAGCTGTGGTAG
AAGCTGAGAACGCCAAGGACAAAGCTCTCTTTGCGAAGACAAAGCAGGCGCTTTCGTTGCTCGGACTCGGCCCAGCACAGCAAAACGACCTGTTCCAGGT
CCTGTCGGGCATTCTGCACTTGGGCGAGGCTCAGTTCTCTGCAAAACCCGACAATGATGAAGCGTGTGACCTGGACAAGGACTCGGTTACCTATTCGAGC
ACGCTGCTCGGTCTGGACCCAGAGACCATGGCCAAGGCTCTCACCCACCGCACTATGAAAGCTGCTGGAGAGGTATATCTGGTCCCACTGACGATGGAGC
AGGCTCAAACTGGGCGTGATGCACTCGCTAAGGCTATCTATGCGAGCATCTTCGACTGGTTGGTGGCAGGTATCAACGCCAGTCTTGGTGCGGCACCACG
CCGTACTGCGAGCACGATCGGGGTGCTGGATATCTTCGGCTTCGAGAGCTTCGAGTACAATTCGTTCGAGCAGCTCTGCATCAACTACGCAAACGAAAAG
CTGCAGCAGAAGTTCACCCAGGACGTGTTCAAGGCCGTGCAGGAAGAATATGAGCGCGAGCAGATCACGTGGGCGCACATTGCGTACGCTGACAACAGCG
ATACTCTTGCACTCATCGAAGGTCGTATGGGTGTGCTCGCTCTGCTGAACGAGGAAATCGTGCGCCCTCGAGGCAACGAGGAAGGGTTCGTAAGCAAGCT
GTCAGGTGCCTACCTCAAGCAGAAGAAACTCATCGAGTTCCCACGGATCTCCAAGACCCAGTTCGCCATCCACCACTACGCCGGAACGGTGAAGTACGAG
GCCACGGGGTTCCTGGAAAAGCACAAGGACGCACTGCTGTCGGACCTGTCCGATCTCATGTGCGGCAGCCACGAGCCGTTCCCGCAAATGCTCTTCAAGG
TGAGGGCTGAGATGGAGGCTGCATCTGCTATGAGCTTGTCCCGCTCGACTTCAGGGAGCCGGAAGGCGGGTAGTGCTCGCAGTGCGGGATCCGACAAGAC
GGTGGGCATGCAATTCAAGCAGTCTCTGAACTCCCTCATGACCAACATCAACGAGACCAACGTCAACTACATCCGCTGTATCAAGCCGAACAGCGTCAAG
AGCGCCACACTGATCGAAGACAAGATGGTCGCCAACCAGCTACGCTGCGCCGGTGTCATCGAGGCCATTTGCATTGCTCGTGCTGGGTACCCGAACCGAC
TGCTGCATGCTGAGTTCGCAGAGCAGTTTGACATCTTCCTCTCCGAGCAGCAGCAGAACCAGTTGCAGGAGGACGCAGCAAAGTATGGAGCGCCTCATTG
CCGAGTCTTAGTGAAGCAGTTCAAGCTCGTGATGCCCGAGGAGTATCAGATGGGCGTGACGAAGATCTACCTGCAGAAGGGTGTGCTTGAAAAGCTCGA