Description :
From Genome Similarity Track
Location :
Scaffold_77:51717- 55717
Transcript NameFunction/comments
Phyke_g3253Di-N-acetylchitobiase, putative
Phyke_g3254hypothetical protein

Sequence
4000 bases(100 bases per row)
TTCAGAGCACTCCACATGAGCAGCGAGTCATTGTGCGCCGTATTAGTGGAGTAATCCAATGAGTCAGCATTCCACATGCCCACTCCACGCAAATCAAACT
CCCGAACGAGCTGGTACTTCTTCTGCAGGCTCTGTGGATTGTCGAACCAAATCTGCGAACGAGGCGGTCCCTCGGGCGAATACCATACAAAAGGGCTCTC
CGACATCGGATCCCAATGCTCAACAAGGCCGTGGCGCTTCACCAGTCGCCTGATTTCACTGTAGTCTATCTGTCCACctgctgcatcactgcaAGGGGCG
CCGAAGAACGGCACCGGGTGGATCTGACATGAGACGTCGTCAACTGAGCCAGTGCTCTGGCAGGAGTAATTGTAGCCATACCACGGCACTCCAAGCACCA
ACTTTTCCGACGCGATGCCGTATCCGAGCAGGAACTCCTGCAGACCTTGCTTCACGAGGGCCAACGGGGAGTTGGCTCCAGCTACACACGCGTCGTAGAC
CTGACTGCGCATATCGTACGACATGACGAACAGGAAGTCAACGGCACCTGCCAGTTCACGCCATGGATAGTACCGACCATCCACACCACGAGGAGCCCAC
GGGACGTCAAATGTAATCTGCATTATCAGGCAACACGGCAAAGGTTAGTGGTCAGTACCAATGTATCTTGATTTTGAGTTACCATACTCCAGGTGGCACA
CCTGAGAGTTCCGTGTGAGCGGATGCAGCTCTAACTCGCGCCGAAGCTCTTGCACGAGCAACGTGAGGCAGCGCGATGTCGGCTCATGCATGGCTTTCTC
AGTGTCAATGTTAACGCCATCAGCGTAATTCTCTACAATCATGTTGTACGTTGCCTGCAGAATGCACACTGTAAGCCCTCCCTCCTCACTACAAGTATAA
GTATGAATTTGTAAGGAAGCACAATGAACACAGCACCTACCTGGACCCAGTCTCGGCGCGCTGTGGCATTGCACAGTTGCTCCACATCGTCAAAGTTATG
CTTCACGACAACTTTCACTCCCTTGTTGTGTGCATGACAGAGCAGTTCCTTGTCTTCGTTCCAGGCCACTGTCGTGAGCTATTCGAATCCACACTCTCAG
TAAACAAACAGCCCAACGTTGCAAAATCCTTGAGCTCTTTTGCGATACCTGATCCCAATCGTAGTGTTTCCATCGATCATCTGTTGTTACAGAGAAGGCA
AACACCTCTTTTCTCGGTTTGCTGTTAGTGAAATCCCCTTGGGTGGCGAAGTCGACGGGGAGACACAGTGACGAGAGCTCATCACTACGTCCTTCGCAGG
GGCAGTCCAGTAGACGAGAACGATCCTCATGGGTCAAGTGGTCCACGAAGAGATTATGTGTGTCGTACACCGGAACGGAGCGAGAGATGCATACATGTAT
TCCCACCACCGCCTtcagtaccagcagcaacagcagtcgTCGTGTCATTGGCGGCATATTCCGCCCAAAATCGTGATCTGATTTTCacggtacagtgtac
cacAAAGCGCAATGGTTCaattgctgtggctgctggccaaggaaGGTGCTACCAGATTGGCGCACTTGTGTTCACTGGCACTCTGCGTTGGGAAACAACA
GCTATCCTACTGCACCTGCGAACtaatagcagcagcatgcgCCAGTCCATCAAGCACTGATACAGAATTCTGGAGAGaatggtacactgtaccaaATCAC
GAACGGTTGTGTCCCTTCATGCGCATAACGTATCTTTGATGAAGCTCACTTCGAGTTGGGGATTTAAACCATGGCACGGACTAACAACGCGCTCATTATG
AGCATGGGCACCGTCAACATGTGGGGATTCTCCCCTGCGTTCGATGTGTGCAGTGGCACATTGAACGAGACCAAGACGTGTACCACCGTCATGAATACGG
AGGAGAAGCTTTCGACCACGCCAATCAATGTGCTATTGGCAGGACCTGCAGACGTTCGCCATGTGTTGGCCACCATCGCTCGTCGTCACCGATGGGACCC
AGTGATGAAGCACCGACCTGTGCATATTTACATCTACGAGAAGTCCATCGAGACACTTTCGAGACACTTACTACTGATTCAAGTGGCTCTCGACACGGAC
CTCCCGTTGCGAAAGCGCTGCAATACCTTCTTAGAGATCTATGGGAATGCGCGTGTGCAAGTACGTTGATGGTCCAACATAGCCGTGCAGTAGTTAGTAT
CTTATTTGAACTGTTGTGTTGACAAAACGCTGTAGGAGAGGACGAGTGCGTACGTCGAAGAGCAAGCAAAAGTGCTGATAGACCTCATTTATAACGAGCG
AGGTCCGCTGGCTGGTCTCATTGATTTCTCGCATTTGAAGATGCGCACTCAGGACGACCTCATTGACACGTTTCGAAGCTGGTTCCAGAGCGTCAAGTTT
GATGGTAAGAAAATTTTTGGACTCAGTGGAGGATACTGTGGGCTAAACCGTGATTTGTAGTCGACACGCTTCGAGatcatcgccttcgtcacTATTATGA
AGTCCGTTACGACTATCGTGACAACCTGATCGACTGGGATTACACCGTGGGTTTTGTAGACAGTATTGCTGTTttggcgacgacgatactAACTCTCGCT
TCATGTACAGATGAATCTCAAGAAGATCGAAAATGCCAGTGTAATCCATGTTCGCCAATACCGTGAGTGGAGGAACTCCGGGGTGGCGTTCGAGTTTGGA
GATCAAACGTATGCGGTGCCGAACCGCACTATGGCAGCATATACTGAGGTAATATGATAATGTGGATTCGTTCGGTGAAGATAATGATGACTACCGATAT
TGCGTGCTGCATGGACAGGCGAAAAAGAAGCACCACGGATCTGTGCTGTGCAGGGGCATGTGGACAGATATTATCATTAGTCCATACATTTCGTTTGGCG
TCCAATGCGAGAAATCCAACCAGTTTGCTGAGCAGCTCTTTGAAATCCACAACAAGGGCACGGGCGTCGAGCAGAACCGCCACGTatgtgcttgttgttg
taaGAATGGTGGTATGATCTCTAGGAGCTCATAACTTGACTTGTTTACGAAATATACCCAGAACACGGTGGAGATTGCGATATACAACGTTCTGTCATAT
CTTTATGAAATCGAGACGGGCAAGATGTACAAGATGGACAAGGTGAGTGTCGAGAAACATTGCTGCTTAGTTATCTATACTTCACAGATTGCCACTATAT
GGTTGGTTGCTAGGCACACGACATTTTTAGTGGTATTGGCGATGCGGAGACAGGAACCCTCGACGCAAATGATCAGACCAAAGGTGACAAGCCAGTGCCG
CGGTTCAAGGAGTTAGTTGAGGACGCCGACGAACCTATGGCTCCTGAAGAGTATGTTGCTGCGAATGCCTTGTCATTGAGTTTTGGGCTTACTCGGTACT
GTCATACTAGCCAGCAAAAGAAGCACGACGAAGCACAAGAGCGTGCTCGGATGATCAAAGAGTCCTTCAATGGGGTGAAGGTACGTGCTGCGAATTTGAT
GTCTTGTGTGTCGTAGACCTTGACTTACTTTGCGTTCGCTGCAGATCATTCCCCTGACAGGGAACATGGAGGGTTTATACTCGAAAAAGCGCTATACGAA
CCTTTTTGACCACGTCTTCATTTCTGCCCAGCAGTGTCACACGCTACAACCTCCTAACGACACGGAACAACAGCCGGCAGTGTCGTTCACAAACATGTTA
AAAGATGGCGCAACCGTAGATGTCGAATCTTCAGTGTGAGTGTATCTACATATTCACTTGATGCCATAGGTACACCAGGTGTGTAAAAACGTTTGTATCC
GCAGGTTTCTGCTGCCACTGAAGGAAGAACAAAGAGGTGTCTACGTGACGAAGCTGATTGAATGGACGGTATATCATTCGTTGAAACCCATATTTGCTTT
TGATGGCAAGGACGAGCCTTCCAAAGAAGACATGACCAAGATCAGGAATGCAGTGCTGCGTTTCAGCTATGAGCAAAAGGAAGCCTAAGGTTTTCAAAAA