Description :
From Genome Similarity Track
Location :
Scaffold_307:5170- 9264
Sequence
4094 bases(100 bases per row)
TCTGGGTCGATGAACTCTGAAGAAATTGTGGAGTACAAGCTGAACCCTGGAGAGCGCTACGGATGGTGGGAAAACAATGATCCTGACCCAAAGAAACTTG
ATGTGGCGATGGTGCATGGTGCTGTGAACGACTGCCGGACGAGAGTTCTCCTGGATACCGGTGCGACTATGAATATTGTGAGCTTCGACTAAGCGCGTAA
GCTCGGACTCACACTCAAGTCGCACAAGCAAACCAAGGTGTCTGGCATGGGAGGCGTTCCGACGTACATCGGTACCAGTGCTCAGGTGAAGATTACTCTC
GGTTCGAGGGTGATATATCTCCTGGATGTCTGGATTGCTAACATCGGCGAAGGGATCGAAGTACTTCTGGGTATGAGTTTCATGTTTGCAGCTGGAGTGA
GGATCAGTGTTCGCGAAGGTCTCGTGACACTTCCGGATGAAGAGGCGATCATGATGTGGGGATGGACCCCAGAAGATCGCCTGGGTGTCGACATGCCCGT
GGAAACCACAGGTAGTTGGTACCTGGCCCCTGGGGAATCCAAGGTGGTGAAGATTTCGTATGGACCGACGAACCCACAGCGTGATGGTGTGTGGGCAGGA
CGAGGTGACCGCTGGGTAGCGCACCTGATTTACGCTGCGAGATCCTGGCCGGTCGCTGTGAAGGTGGTCAACATCTCGGACAAGGACGTCTGGATTCACA
ACAGAAGGCCAGTCGCCTGAATCGTGGAGTATGGCTTCTTCCCACGTGCCGGACGCTTTGTGCGGCCTGGTTCTTTTGCGTACCGGAAGTGGCAGACTCT
TATTCTGGAGAGTGTTCAGTCGCGTGAGGGCAGACTTTGTGCGGAACGCCTGGCTGCGCTCGAGCCATCCTGTGTCGAGACCCCAGAGTATCAGTGGCCT
ACGAAGATTCTGCCGCGACCTGCAAAAGGCCCCGACATGGCACGGCTTGCCTCGATTCTCAGGAAACCGAAGACTCGTCGCGTGCGCTTCGCTGAAGACG
CTGCAACTCAGACTGAAGAGGTGCCCCCTGAAGACCCTCCTGAATTCCGAGACGTTGCTGTTGATACGAGTGACTTGGATGGCGTTCTGAAGGATGCGGG
GACCGATGTTGCCTCGCAGACTGTCGGAACCCCAGAGTACACGAGTCCTGAAGGTGATACGGCTGCTGAACACCTGAGTTTACAGGTTGAAGTTGGCAGT
GATTCCCAGGGTCAGTGGTGCGAGGAAGGTGATTCTCTGGGATTCGATGTGGATGATGACGATTCTCAGGGTGCTGTTGAAGATTACTGGGATATCCCGA
TCTCAGGGATGCCGGGAACCCCGTTGAAGAAGCTGAAGCAGGAATATGAGTGCTGCATGCGGCTCTCGACAGAGGACCTCGACTACGAGCCTGCGGTCTA
CATACGCGAAGGAAGTGAGTTACTCTCTCAGTTGCGCGACCAGTTGGTTATGCTTCCTGAGATGCGTGACTTGACCCCTGAGTGCAAGATCGAGGAGGCA
GATGTTGGAGTCCCTGGGAAAACGACGCCCGAGATGGAAGACCAAGTGAGGCAAATTCTGGAATATCATCGGAAGATCTTCTTGGGAGACGACAATGCAG
CTCCCCCACCTTCCCGTGGAGTGGTTTGTGACCTGGATGTAGGCGACACTAAACCTGTTGCCCAGCGTCCAAGGTCCATTGCACCACACCTGTGAACCAA
GGTGTATGAACTTCTGAAGAAGCTTCTGGAGAACGGGCTGATCGAGACTTCTACGTCCCCCTGGGCATCTCCGATCGTGATCGTCCTCAAGAAGAATGGC
GTTGACATCCGGATGTGCATCGACTACCGCGTGGTGAATGGCTTCATCAAGCTCTCGCACTACCCGCTACCGCTTATTGATGATCTTTTGATTGGCTTTG
AGTCAGCGATGTGGTTTATGACCTTGGACATGGCGAGTGGTTTCTGGGCTATCAAGATGACCGAGAGAGCCAAGTTGATATCTGCGTTCGTATGTCTCTA
TGGGCACTACCAGTGGGTCAGGATGTCGTTTGGCCTCAAGGATGCCCCGCTGATCTACCAGGCAGTTCTCAATAACTGTCTGTGGGGATTTCTGCGGCTT
TCCCCTGAGGAAGAAGCTGAGGTTTACCAGGATGTCTTGGACTTTTTGGGGTTGAACTCTAGGGAACCCAGAGTTTCAGGTGAAAATGCCCTGCGGCTTT
CAGTGTTGACGGATGAGATGACTGTTTTTCAGCGTAACATCCTGGCTCCCTCTCAGACGGGCCCTGTCCTGGGTTGAAGCTCGTATATCGACGATATCGC
CCACGGTGCGCCTACTTGGGAGCGGCTGTGCTAGGATCTGAACGCGCTGCTCTTCCGACTACGTTACTGGAATATCTCTGCGAGTCTTCCCACGAGCGAA
TTCGAGAAGTTGTCTATTCCGTATCTCTCTCACGAGATTAGTGCTGAGGGTATCCGAGCGACCCCTAAAATCGCGAAGGGGGTCCAAGACTTGCCGTTCC
CGACGACACTGAAAGGTGTCCAGAGTTTAATGGGGAGTCTAAATTACTACAACAAGTTCATTGAAGACCTACCCGTGATCGCGGCCGTCCTGTACGAACT
GACTGGGGAACAAGTGAAATTCAGGAGATACCTGTCGAGAGCCCAGGAAGCCTTTGAAATCCTGAAGCGCAAGATTGTTTCGACTCCGTTGCTCAGACAT
CCAGATCGTTCAAGGCCCTTCGTGATTATTCCCCACGCGAACCCGTGGGTGTGTTGGGCCAGGAGTACGACGGGATTGTGCACCCGGTTCGATTCACAGG
TCGCGTCCTGAATGACGCTGAGCTGCGGTATCATATTGCGGAAAAATAGGTGATTGCTATCCTGAGAGTCCTGGAGGTGTTTCGCACTTTGGTTGAAGGC
AGCCCTAAGATCGTCGTCTACACGCGATATTCTGTGTTGAAGTGGTTGCTGACCTCGCAGTCGGCAGGCGGTCGAACGGTGAAGTGGGGTCTGAAGTTGT
CCCACTGGAACCTGGAGATACGCAGAGTTCAACGGGATGAAGACGGCTTGGCTGCAATTCTGGGTGCGGGTATTTCCCCCAGAGAACACTTGGATGAGAT
CGCTGAAAACCTGATCCCAGCCAAGGCGCGCGTTAAACCTCCAGTGCCTATCAGTATGGAAATGCTGGAAGCGGACTACGAGGGGTGTATTCTGAGTTTC
GATGGCGCCGCTAAGACTTCCACGCGACAAGGGAGCTGTGGCTGCATTCTGTGGCATGTCCCTGGTTGGGAAATCCTGGATGCCCAGGGGTTCATCCTGG
AGGACGTGACTGTGAATGACGCTGAGTATCATGGACTTCTGAAGGGCCTCACTCTGGCGATTGAGCGTGGAATTCAGGACATCGTTGTGGTTGGGGACTC
CAGGATTGCCATCCAGCAAGCCCAGGGTCTCATCAACTGCAATCAGCCAAATCTCCAGAGGAAGCTGGCCGAGTATGAAGTGCTGAAAACGAAGTTCAAG
TCTGTGCGGCTGGTGCATGTCATGCGAGAGTTCAACCAGGCAGCAGACTACCTGACGTCTCAGACCCTCGCGCTTGGCGAATCCTGGAAGGTGGAACGAA
CACATCTGCAGATAGTGTCCAGGATTCACGAGAAGTTGGTAAAGCCGAAGGTGTTATTGAACGTTGGAATTCAGGGGAGGGATTCTCAGGGTGTCGAAAC
TATTGGTATCCCTGGACCTAAGTGCGCTCCGTTGCCTGTGGCGGCCAGAGTGTTAGCAGTAATGACTCGAGCGCGAACTCAGGAGATTGAAGCCCAAAGC
GAATCCATGGGACATCTGGAATACCAGGCTGAACGCTGGCGACGCATCAACGTGCACCAGGACAAAGATGATCACCTGCTGCAACTCAAGGATTTCCTGA
AGGGCGACACGACGAAGCTGTCGCATGCTCAAGCCAGGAAACTCGCGAAGGTCGCTGATGATTTCGTGTTGGATTCCAGAGAAGTCCTGTACCGCTTGAG
TCGGTCTACCAGAGATCGACCCCGAGACATGCTTGACGAACTCAGACTCGTGGTGCCGAAGGCTATGCAGCCGGATATCCTGCATTACGCTCAC