Description :
From Genome Similarity Track
Location :
Scaffold_2140:517- 3014
Sequence
2497 bases(100 bases per row)
TAATGCTGTAGGGTTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTT
GAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGG
ACTGTCCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATT
GATTCCGTAAAGCGGCGCTGGCCAATCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCAT
CACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTT
TTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCACATAAGTGGATCTGGCCCGTA
CAACTTCTCATCCAGGTAGTCTCCACAGTATCGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTC
GTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTG
ATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGCCCCAAAC
GTCCTTGTAACCCGGCCAACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATATTCCCACCAGCAGGTTGTAATTCAGATCCAA
CACGCGCAGGAGCGCGATTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCC
TCATGTTCTTGTACCAGAGCTGTTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGG
TCGCGATCCTGTTCCTCAGTTCCACAAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCATTTTCCATGTTCTGATCCGTCGTCTCTATTTAGACTGG
ATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGG
GCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGTGCGTAAT
CCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTT
AGGATTCGCCTCCGATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACACTGATAGAGAGGTTCCAC
TTAGTACACGCCTCCAGTAGGGATGTTACTCTTTCGCACAACTGATTCCACGATTCCGCCGAGATTAGAATGTCGTCGATATAAGATCTGCGTCCTAACA
CAGACAGAGTCCCAGGATCCCCCGGTTCTCCTGCTTCGAATGGATCTACTTCCGTGTGATCCTCTCCGGATCCACCCCTTTCGGGTTCCGGTATTCGGGT
GAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTG
ATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAACCCGCTGGCCATATCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTT
CCAACAGCTCATGATTAGAGGCATCGGATACACCACCAATCGAGTCAGACTGTTAATCAGCCGGTAATCAATGCACAGACGTATATCCACCCGGTTCTTG
ATCCTGTCTGGGCGGTGTTTATCGCGAAGGAGAGCGCGTTCTGGCGTACTACATACAATCCCTCTGATCCAAATCCTGGAGCGTACATCTTGAGTGCTCT
GCGTGATGCGTCTGTACACATGCGCTCGCCGACCGCGTTAGCTTGGGGGCGATATGCCATGGTTGCTCGCTGTCGTGGCCCCAGGATCGGTTGAAATGCT
CGGAAAGAAATTCGAGACATAAGGCGGGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGG