Description :
From Genome Similarity Track
Location :
Scaffold_481:5168- 7502
Sequence
2334 bases(100 bases per row)
AGGAGACGACAAAGTCGTGACATGAGCAAGCTCATAATCAGGTCGGCGAGAGAGGGCATCGGCCAACACATTTTGTTTGCCTGGCTTATACTTCACCTCG
AAGTTATATTCCGCAAAGAAGGAAATCCACCGAGCCATTCTCTGAGAGAGGCAACGAGACTGTGTCGCCAAGCGTAGTGACGCACGATCCTTGTAGACGA
CGAATGGCTTGGAACCAAGCAGATGGACTCTAAATTGGACAAGCCCGTACTTCATAGCAAGAAGCTCTTTGTCATGAACTGGATCGTTCTTTTTAGAAGC
TTTCAGTTGACAAGATTCAAATGAGATAATGCGCTCGCGGCCTGCAGCATCTGTTTGCAACAGGGCGCTGCCTATGGCACAGTCGGATGCATCGCAGACG
AAAATAAAATGGTACTCAGGATTTGGCAACGCCAAAATGGGAGCATGAAGGAGACTCTCCTTTATTGCCCGAAATGCGTCAACATGGGTGTTGTCCCAGC
GCCAAACTGTGTCCTTTTAAGGAGATCAATTAATGACCGAGATATATCAGCATAATTTTGACTGTATTTGTCGAAGCAATTGACAAGGCCAAGTTACTAA
CGCAAGTCCTTTTGATTTTTAAAATCGGCCAGTCCACTATAGCCTTGACCTTATTGTGATCCGCTCTGAGGCCTTCCTTACCGATCAAACATCTTAGAAA
AGGAACCTCTTCTGCACTCTAAATGCATTTGGTCGCGTTGGCAAAAAACTTATATGTGCGCATAGACTCGAGACCGGCTCGCAAATGACCGATGTGATTG
TCAACATCTGACCGACCTTGTTCGGCACGACTATAGACAAAAATGTCAGTGCGTAATCCCGATGTGGGCGGAAAAGTTTCATCATTTTAAACGCAGCCGG
AGCATTAGACAGCCCTTTGACATCACCAGCCATGCCCATAGCATACCACTCGGAGTTCTCCCTGCCGAAAGCGGGATATCACTCGCTCTCGTAAGAAATT
GGTAATATCCATCGACCAAGTCGTGTGCGCTATACATAGTACAACCAACCATGTTGTTTTTGATAACATCCTTTCGAGGAATAAGTGTCTGTGCTGGAAT
AGTGGCCGCATTGAGCTTGTTCTAAGCATTTACAATACGCCACTTGTCGTTCGGCTTTTTGACACGAAATGTCGATGTCGAATGTAAGGATTTACTCTCA
CGTACCATTCCTGCTTCGTGCTTGGCACGGAAGAAGTCGTCAATGACATCACATTGTTCCTTAGGGAAGGGCTACTGTCGTGTGACACAGTATTAGATTC
CAGGACCCAAGTTAATATCATGACGGACACCTCTATCTGGAGGTAAAGCAGAGGGTGGGTCGTGACACACCACATCTTGAGATTCCTTGACCAAAGGATA
AAGCATCACGAGGATGTTCAACATTGATGACCCACTACGCTCACGAGTGCCGCTTTTGTGTTATCTAGAACGGCTTCATCCAGAAGCGAAGAAGAGTTCA
ACTCTATGATGTCTGGTCGAATGATCACCACCTCTGGAAGGTCTCCATTCTTTAGTGAGTGAATAAACCCATCGACTAAAAACTCTTCAAGTTCTAGAAG
AGTGCCTAAAAAGGGTATAGCCTCAAGGATAGACGTACCATCATAGACACCAGTCACTCCGTTGACGATTGTATACAGCTGATAATCATCATATTTTCGT
GACACAGCTCGCGCTTTGTGACTTGTATCTTTATAATCGAAGTCATCGTCAAACTTATTTTGCTCTAAGATAGAGCTGATTTCGCTATCGAAATCTGATG
ACAAGTCATTTGACATGACGTCATCATCACGTGGATTACGTGCACTTCACGCACATCCGCTGATCCGGGCTCGGGATGCCTTGGTATTTCACCAACAACG
ACAATATTGACATTTAGCGCGTCGCTACCACATCCAACGTCACTCATTAGGTACCACTACACGCTCATCTGATGGGTCCAAACCTCGATGACTTGACGCT
TGGTCAACAATGCTTTGATCATTCAGTGTTTCGTTCTCACAACTACTACTACTCAACAGAGTACGTGCCGTTTCACTATCACATAACGAGCTTTGCTCCA
TACTCATGTCTTTGACATTATCAGAATCAACTGATTCCGAAATTATGAAGTCCAACACACTGACATTTTCAGCCAGGGGCTCGCGCCAATAGAGCTTCTT
ATTCCTAGCAGAGATGCGTTCATGACTTTACAAAGCTCCGCTAGTGGCAGTGCGCGTTGCGCCTAATGTTATTGACACCCAGTCGATCCATGGATCGTGG
GGATCAAGCCAGGCCATACCAAGAATGAGATCAT