Description :
From Genome Similarity Track
Location :
contig_65:51678- 52830
Transcript NameFunction/comments
g11724.t1hypothetical protein

Sequence
1152 bases(100 bases per row)
GATCGTCTCGGCGAGCTTGATCTTCACGACAAATGTGCGAGGGCCTCGGAACGGGCGGCGAGGCGCATCACCTGCAGCTGGTGGCGGAGGAGGCGGAGGG
GTCGGACTGGGGCCGTCCGGGTTAACGTCGACGAAAGTCTTGGTTTGCGCTTCCCACGGTATCATAGCAGGCGCATACATGGCAGACATACCGTCATGCA
CAACGCGGATGCCACCAAACTCAGTCTCGTATTGACGGAGAGCAGCGTTGATCACGTTGCGAACCAGAGCGCGTGGAAGGGGTCGTTCCGGGCGCTGTTC
ACGTTTAGGAGGTGCAGACACGTCGCTCATTTCCACGTCCTTGTCCTCTTTTTCGTCTTTACCCTCTTGCTTTGGTTCGTCACCCATGGTCTCATCCTTT
TGGTCTCCAGGTGTACCGCCAGAAGGACCGTACTTCGAGTCTGCTGCGAGGTCAGGCGAGCGCTCGACATCCACGTGGTATTTGAAAATTTCTGCTGGAA
CCGTGTCGAGCGAGACACCGAAGTAGTTCACACTCAACTGCATCGATTTGCCACCTCTGGCGACGCCCGGGCGGCGACAAATAAGAAACTCCTGCTGGAG
CTCCGGGTCTTCAGCGCTTACTTCGCGCACGCCCGCGCGACCAGTCCACTCGTCCTGGAGACGCGGGTCAGCCACGGGATCACCCAAAGTCTCATACCCG
GAGCCAGTCACCGTGCCAACACCGGGGCCTGACTCTCCGCGGCCACCGCGACCCCCACCACCTCCAGAGCGACCGCCACCGCGGCCTCCACCGCCGTATC
CACGATCTCCTCCACGGTCACCTCCACGGTCACCTCCACGGTCACCTCCACGGTCACCTCCGCGGTCGCCGCCACTGCTACCACCGTATCCACGATCTCC
TCCACGGCGATCACCACCTCCACGATCATCGCGGCGTCCGTAGCCACGATCACCTCCACGATCTCCACCACCACCATAGCCACGATCGCCGCCACTGCTA
GCACCGTATCCACGATCATCACGGCCGCCACCAGCAGCCGCTCCACCACCATATCCGCGGTCATCCCGGCTGCCATATCCGCGCGAGCGGTCATCATGGC
CACCTCCTCCATACCCTCGGGAGCGGTCGTCATGTCCGCCGCCGCCTCCCCC