Description :
From Genome Similarity Track
Location :
contig_27:516634- 518072
Transcript NameFunction/comments
g5993.t1hypothetical protein PHYSODRAFT_338448

Sequence
1438 bases(100 bases per row)
GCGCTGCGACCACGGCCTGGACAACATGATCGAGCTCAACCACCTGCACGAAGCGGCGATTTTACGAAACCTCAAGAAGCGCTTCCGGGCACGGATGCCG
TACACGTACACGGGGGATATTTGTCTGGCCGTGAACCCGTACCAGTGGCTGGACGAGCAGTACAAGCCCGGACTTCACCAGAAGTACATGCGGGCACGAA
AGCGGCAGGAGCTACCGCCGCACGTGTACGCTGTTTCGGTCGCAGCTTACAGGCATATGTGCGATGTCGGCAGCAACCAGAGTATCCTTGTGAGCGGCGA
GTCCGGCGCTGGAAAGACCGAGACCACCAAAATTCTGATGGACAACCTGGCCACGATCGCGCCAGCTCCGAGCAGCTCACCAAGTGAGCAGGAAAACAGC
ATCACCACGCGTATTATCGAGGTAAACCCGCTACTCGAGAGCTTCGGCAACGCCAAGACCACTCGCAACGACAACTCGAGTCGCTTCGGCAAGTTCACTC
AGCTCCAGTTCGACAAGAATCACGCGCTTTGCGGCGCTCAGTGCGAGACATATCTGCTAGAGAAGACGCGCGTCATCTCACACGAACGCGGTGAGCGGAA
CTACCATATTTTCTACCAGCTCTTGCATGGCCCCACGCCAGATGAGCGCGACGCGTTGGGTCTGGGAGACGAGAGCCCGAAGTTCTCGTATCTGCAGGAG
AAGGAGCCACAGCAGGAGACGAGACCAGGACGAAAGCCCAAGCCATGCGCGCCACCGCCGCCCAAGCCAGCAGCTGTGGTAGAAGCTGAGAACGCCAAGG
ACAAAGCTCTCTTTGCGAAGACAAAGCAGGCGCTTTCGTTGCTCGGACTCGGCCCAGCACAGCAAAACGACCTGTTCCAGGTCCTGTCGGGCATTCTGCA
CTTGGGCGAGGCTCAGTTCTCTGCAAAACCCGACAATGATGAAGCGTGTGACCTGGACAAGGACTCGGTTACCTATTCGAGCACGCTGCTCGGTCTGGAC
CCAGAGACCATGGCCAAGGCTCTCACCCACCGCACTATGAAAGCTGCTGGAGAGGTATATCTGGTCCCACTGACGATGGAGCAGGCTCAAACTGGGCGTG
ATGCACTCGCTAAGGCTATCTATGCGAGCATCTTCGACTGGTTGGTGGCAGGTATCAACGCCAGTCTTGGTGCGGCACCACGCCGTACTGCGAGCACGAT
CGGGGTGCTGGATATCTTCGGCTTCGAGAGCTTCGAGTACAATTCGTTCGAGCAGCTCTGCATCAACTACGCAAACGAAAAGCTGCAGCAGAAGTTCACC
CAGGACGTGTTCAAGGCCGTGCAGGAAGAATATGAGCGCGAGCAGATCACGTGGGCGCACATTGCGTACGCTGACAACAGCGATACTCTTGCACTCATCG
AAGGTCGTATGGGTGTGCTCGCTCTGCTGAACGAGGAA