Description :
From Genome Similarity Track
Location :
contig_142:51656- 53532
Transcript NameFunction/comments
g11612.t1hypothetical protein

Sequence
1876 bases(100 bases per row)
AGACCAGGACCGAGACGCTGGACCTGATGAAGGTGGTGATTTGGCCATCCTCCGTGCTGCCCATTACTGAGTCAGAAGTGCCCGAGGGACTCGAGTTTGT
GGACATTGGTGACGGGGATCCCTGCCAATGCTTTGGGGATTGCTTCATGGACTCCTGTAAGAACGCTCTACTATCCATCTACTGCACACCCGAGTGCTGC
AGATTAGGAGGAGTCTGTAGCAACTCGCCGCGCAACCACCCGGGTCTGAAATTGTACGACACCTGTCGTGTGGGGCTTGGCGTGCACACCACTGACTACA
TAGAGGTGGGAGATGTTGTCAGCGAGTACGTGGGGCGGTTGTTCGAGTACCCCGCTGTGCTGGAAGGCCAGCCCGCACTGGCCATCAAGCAAAACAGCGG
CTACACCATGCTGCTCAACACGCAGTCGGTGTCGGGCATGTTCGTCTACATAGAGGCGTTGAAGTGCGGATCAATCACAAGATTCATGAGCCACTCCTGC
GACCCCAACGTGAAGTTCGTCGAGATGCAGAACGGATCCAAAGTCAAGGTGCTCGCTCGGATGATCAAGACCGTTTGGCCTGGCACGCAGCTCACCGTCA
ACTATGGTGACGAGATATGGTTCAAGTGCGGGTGCGACTCATGCTGGGTTGACCCCGTTGACGAAGAAGAGTAGGAGCAGGTTGGAGACACAAGTCTAGC
ACTTCGATAATAAGCCCAAGTCGTGCAGAACATGCATAATTATTCAAGTGAATGTCCACTCTGTCTTTACCAAGCGAGGAAATCGTCCAAGTTATTTTTC
TCGGATTCACTTGATCGACATGGATTGTAACCAACATCTGACCGACTCTTCGCGCTTGGAATCGTCGAAGCTCAGCGCCTGGGGACATTCACAGCAAACG
ATCACATGTAGTAAGTGGCCAGTAGGGAGGGCAACACCATTGTGGGCTCGGGTCGACTCTAGTTGTGCTTACCTGTACCCTGGACGTGTTAGAAAGTCAG
CGCTGACCCACCGACAAGGGTCTCCCTCCTTCAAGGGCGTTCACGGTCTGTCGCTTACGTTTAGACTTCTTGCGACTCACGAGCACCTCGTTACCGGTGG
CGTCGATGTAGCCCGAGCTTCGCGTCGCGTAAAGCACGTGGACGCAAGAGCCAAACGCGAACCAGTAGCTACAGCGCACCACTTGCGGTCGATGTCTACG
ACCCACCCACTCCAAGGCTGCCCTTCCACTTCCATGCGGGCATAGTTAGACCCCATTTGAGCCGAAACTGCGATAGCTTCTTCCGACCGTTTGTTGGGAA
CAACGCTGACGCGATCAACGAGGCGTGACTGAACCTGAAGGGTGCGCGAGGCTCCAGCGCCTGGAATTTCGAGTTGGTTGTCGTTCCACTTCCCCAAGTA
GCCTTTGCGCTCCATCTCTAAGGCTCTGCGCGTGAGGGTTGCTGGTGGAACGACATCAAAGCGGAATGGGCGGCCGTTAGACAGAATTGCATACCAGCAA
TCTGTAGCGCATCTGATGCGGAGCGACGTCGGAGCAGGCCGTGCAGGCCATGGGGTTGCTCTTCGTGATCCCTGCCGATCGTCTGGCACCCAGCTGCGAC
ATTTGGGCTCCACGAGCGCTGGTTGGCTGCTTGGATCAGCCGCCAGGCCCGTTTGTGCGTTGGTTCAGAGAATGAGCAGATGTGAAAGACCCGACATCCG
TTTTGTGTTGCTACCGTAACGTGTGTCATTTCCCTACTTCTGAGGTGCTGCCCCACAGTTTTGGTTCCACGTAAAGGAAATGCGGTGCGAGTCACGCGTT
CTCCATAATCCTGGCGATCAAACGAGATTAGACACTACGAACACTCAGCTTCACCGGAGCTGAATTTTGTGCGCCA