Description :
From Genome Similarity Track
Location :
Scaffold_20:51650- 53208
Sequence
1558 bases(100 bases per row)
AAACTAGCCCAGATGTGCATGACTTCGGGTGGCCGAGAAGTGCGGCGATCACGCTATAAAAGTTGGAAATCGCGCGTACGCCATACCGGCTGTTCCCAAT
GATTCACGTTTCTAAGTTGATTCTAGTTCGCGTGTTCCCAGAACGCCCTACGCGTAGGTTGAATGTGGATGAGGCAAGTCATTTCGATTTTGACGAAGCC
CTGGTGCCTGAAGATAGTTGGGAGGGTGATCTCGACGCAGACGAGTTCGAAATAGATAAGATTATCGATATGCGATCGGGACGGGAGACAAGATAGGGTC
AAATACACAAACTGTACCTGGTACAATGGAAGGAGTACAGCGACCCAATCTATATTCATGAAGCTGATCGCAATTGTGGAGCTATGTTGCAGGAGTTCGA
TCGCTATCGGGTGAGCAGCAATCGTTTTGAGGTGATGCAATCGCATGAAGGAGAAGCCCGAGATTAGCGATGATCGGAGAACTTGAGTGGATGTGTCTAT
GCAGGGTAGGTGCATGGAAAGGGAGGAGAGTTATGGGTGCAAGGAGATTGTACATGGAGATAGAATGGAATTTGTGTGAATTGAGTGCGATGATCGCAGA
CAAAATGGTGCATTCACGATCAAAAGACGTTAAAAAGAAGGAAGGAATACGGATTATGGGAGCGATCAAATGGAAATGAGAAGAAATTATAGTGAGAGAT
CGCGTTATGGAACTAGACCAAAGAAATTACTCGCGATCTAAGAACTTACCAACTAAGCGTGGAAGAGACGACCCAGGGTGAGAGGCGATCGAAGTACGAA
ACTGCTTCTCCAACGCTTGGCAGCATGATCGGTTGACAGAGCGGTGATCAAGTTGGGTATGTTGGTCCGTTGCACGGAAAGGCCGGGATACCACACCCTA
TCCTCGTTCAGACGGGGAAAGTGCAGGAACTTCGGATCCAACAAGATGTCCAGATCGCAAAGACCGTCGATCGTGCCCTGCAGGATCAGCTGCAACACCA
TTTTCCATCGGAGACCATCACGAGATCGTCTCTGCCTTCTTTTTCGCGCAAAATCAGCCAGCTCGGGGTCCGATTTACGTTTCGCAGAGAAAATCCACAA
GAAATGTGTCGATTCCCACAGAGCTTGACGATGACAATCCACGAAACCTTGATACGCGTCACACAGTTTTTTTGAACCACCCGGAAGAATTGAACGAGAC
CGGGCATACGATCCGATTGTACACGTCCCACGGTTGCTAATCTTAGAATTGTTTGATCTTGGTGGACGTGATCAGATGAGACGACCAAGAAGAGTTCGGA
GGAGTGGGAATCTTGCCCTGCTGGACAGGAAATATATATCCTTACGGCTTCGAGAAGTGGTGATAAAATAGGTCGATGTCTACTTCCTACATGCTGATCA
AGCTGACCCTTCAAGCGGACCAAGGGGATACGTCCACCGTCGATCGCGGAACCCGATCGCGATACCCGAAATCCAGCGATCGCGTGGCACGGTGGTATCA
GGAAGCGCCAAAATTTCCTCGGCGGTCAGCAGCGAATTACACGGACTTTGCGGTTCAC