Description :
From Genome Similarity Track
Location :
Scaffold_59:51645- 52884
Sequence
1239 bases(100 bases per row)
AGGCTGCCTGGTGACGAATGAGGCCTTGTTCGGCGGTCTCTGACGTCGATGTCGGGTGTTGTTGCAGCCTCTCGGGCGATTGTTGGATCGTTGGGGCTGT
CGTCAAGTGCGATGACCACGCCAGCAGGTCGATCTCGCAGCAAGCCGCAAGCCGCATGCACGCTTCCAGGCGAAGTACAGCAGGCCCATGCGCATTGGTC
TCCTTCAAACGGGGGTAGTTACGAAACAGGTAAACAGTCAGTGTGTCCACCACACGTCGGTTGAGATTGAGCGTAGGTCCATCGAGGCCAGAACACGCCG
CGAAAAGGTGGGTTTGGACGTCGCGAATACGATCTCGACTTTGGGCGTCGAAAATACCCAGGGAAAAAAGAGGGACAGGATCGGAAGTCGTCCAACCGCT
GAGGTGCTTGGCGACCTTGTGATCTTCGCTTGACGTGTTAAATATGTAGTTGAAGCCCTTGTTAGTGGCCGAAATATTCCACGCCCCACGATCGAAGATC
AAACTTGCCGTCAAGTGCTCCGAGCCATTGGCATGCTGTGCCCCCCCGTGACGAAAGGAATGTGATGACAGCTTCTGATCAACGCCAGAGGGTCCACCGA
TACGTCCAAGAATTTGATTGACATGGCAGTGAATAGTAGGTGAGCTCTTGGTCCTTGACTCTTCCTTGTCGAACTCAATAACGCCAGGATTCTGTAGAAC
CTCGATCAATGCAGTTGTTGGGCCAAGGCTCGAAGCTGAGGATGAAGACTGAGTTGGTAAGTTGTCGATGACGTTTGCACATGACCCGCCTTGACAAATG
GTTGCCAACGCCATCGCCAGCAACGGACACGTAAGGAAGTCATTATCCGGGAATATCGAGAGTCCCTGTTCCTCGCTCGTCTTAACGCGTACGAATCGTA
GGAAAAACACACTGCCAGCATCAATGGACACGTTGTTCTTCCGCACCATTGCCAAGTCGGATGCCCGTCCAAGCAGATACCACAACAAGGCCAACAGGGA
TGCGTCTTGATAGTCGCTGCATGAGGTCGCGCTCTTATAGATATACATAAGCATTCGCTTTAAGTAGTCCTTGGTGCACGCAGCTGCCTGGTTCACTACC
ACCCCGCCGTCTTTCTTGGCGCAAACGTTCTGTAGTATCTTGCCCACTCGGAGTAGCTTGGAGTCGACAACAGGTTGTAGGTGGGTGAACTCGTCGAGTA
GTCTCATCTTCGCTTGTTGGAAGTACTGGATGCATGAGT