Description :
From Genome Similarity Track
Location :
Scaffold_155:5163- 9032
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_155-snap-gene-0.14Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_155-snap-gene-0.23Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_155-snap-gene-0.24Gene of unknown function

Sequence
3869 bases(100 bases per row)
CTAACAGAAAGGCTCTTCAGATCCGTCCCACTGTTGCCGGCAGCTGACTTTTGGGGGGATGTCCGTTACGGCGAGTCAGAACCCGTCACTCGTTATTCTG
ACTTTTAGCAACCCGCCACGACCGTCTAACCTGGTGCGGTAGTATTGTTATTCAGTAACAAACCACTCGCAAGCGCCTCCACACAAACAAGCTGCAGAAC
ACGTCCTTCCATACAAAATGGAACTGCAAAGTGTGCCAGTCACATGTTATTATATAAACCCACACAAGTACTGTGGCTGACGCCGTTTGCTACATGCCCC
TTCACGGCGAGGGAGCACGGCTTTTACATGCTCCGGCTCCTGCGTGCAGCGCAGCTGCGCCTCGTCCCGCCTCGCGAATCTCGTTGCTCCAGCCATTTTG
TTCGAGTTAACCCATCACCCGGTTTTTACGCACTTGGTTTATGAGTCCACAACATTTCGACACGGCAAACAAACACAGCATCAACAATAACTCAATGTTT
TTAGGTTTCAGCCAATCAAAATGGGTATAAGTTTATGTACTATTTACCAATCATAAGTGCTATGACCAACGTTCATTTTAGCCAATGGCCGTAATTCTAT
CACTAACCTCTATAATTAAATAACCCCTGATAATAATGATGTAAAATGTACTCTACAATAGCATGCGCTGTCGCACCCAGTGGAGCTGCTGGTGGCGCCA
ATTGGCCTCGAAATGGCTGGAAACAACACCAACGAGGGCGTCGTGCGCTCGCGGATCGACGCCTCCAGCGCGCGCCTCTCGTACGCGAACGCGCTCGGAT
CTCGTTTTCATGCGCACGCTGTCGTTTCCACCAGTTCACTGACGGTTTACTTTTGTTCTCTGTGTGTAGCTCTTTGCGCAATCCTGCTGATGCGAATGCT
GCGGCGCCAGCACGCCGACCAAAGGTACAACTAGTTCACTTTCGCTAACGCGTAGGAGTGGAAGCTCGCGAAGCTCGATTGGTGGGGCTTATATAGGTGG
ATCATTCTTAATGGTTGTTTATGCTGCACTAATGCTTAGTTTGTCCCGAAAGCGGCGAAACGACGATCGGCAGCAGAGGCGGGCGAGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTTGTGGGCACGCTCTCGGGAGGATCCTCGTATAGCACATCTGGCACGGTGGCTCCACGGCCANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGAAGAC
GGGGCGCAACTGCATGATAACTTCGAGGCCATGCAAGTGGAAGAGCAGTGGCCGCCAGTTATCAAGTCCGTGATGGCGCCAATGAGTCTGCCAGTCGTGC
GTCAACGCGAACCAGAGCACGCTGGCGCTGTGTTTGTGGATGCGGTGCGTTCGCTTTGTATTGCTATTGCGCATGGATGGCACCTAAGTCTGATACTGTT
TTCTTCTGGCAGGACGGTCAATCGGTGCTTCCAGAAGACGCTCTCTTATTCATTCAGTTCCCAACGACGCTCCCGCTCGCGAACNNNNNNNNNNNNNNNN
NNNCACGGTGACGCGTCCAGCGCCAAGCAAAGACGATGAGACCATGGAAGATGCCGAGTCGAAAGCGCCGCCGCGCTCCAAGCTGGCCGTGAAAGAAGAA
ACGGCTCCTGCTGCCATCGCAGAGAAGAAAAGCGTCGATAGCGCAGGGGATGAAGCGACTGCCGCGAAGACTAGGTACATGTTTTCTTCCATTGCGAGGA
GCAATTTTGAGGTTGTTATGGAGCTAACTGGGAGAATGCTGTATTGGTTGTGATGAATGTTGCAGTGACGACCAAGTGTACGATAACTCGATAGCGTCTG
CACCAGGCGGCTTCATTGGCAAGGTAAGAAGAATGCTACTATAAATCACTGTGGTTATAGCTTGAGAGTACCTGACTGACTTATCTCTCTACGCCCTTGC
TGGTATTCTAGCTCTGCATTCACAAGTCGGGGAAAATGGTGCTCATGATCGGCGACAAGCAGTTTGAGGTCGCAACGGCGCAGACGCCGTCGTTCTGCGA
AGAAGTGTACTCAATCGACACGACCGAACAGCATCTCTACATGCTCGGCGCCGTCGACCACCACCTGGTGGTCACGNNNNNNNNNNNNNNNNNNNNNNCT
TTGACGCATTGCTCTCGTAGATATATCGGACAATACAAAACAAGTACTTACATACATAGACACGATTGGTTCAACATCATCGCAAAGTGGTAGTGAAAAA
AACCTTGTGAGTGATGGTGTGTATGCTTTCGATCACGTGAATGATGGTGTCTCGAACGGATCCTGTTGAGGTCGACCTGTCAGTCTTATTTCCCAATTTT
CCCCAGTTCTAACTAACTCCCTACGAAAGCGCTTCGAAAGATGAGATCGAAGAGGCAGCCGCCAAAGCCCGTGCTCACTGCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTCGCCGATGCCGAACGCCGCAATATTGTTCGAGAGCACCCGGAAATGAAGTTTCTTCAGATCTCGTCTGAGATAGGACGGCGA
TTCAATCTGCTCACAGATGAAGAACGACAGAAATACGTTGAGCTTGAAGAAGCGGATCGAGCGCGCTACTTGAAAGAAAAAGCAGCATTCGAGAACGCGC
GTGTGGCATCCCGCGCGCGCTTTGTTCGCCAGAGACTCGTCGATAGGCAGCACGGTGCAGAACTCCCGGAGCCTGCGCTCGAACCACTCGACTAGACCTG
ACAGGCATTTCTTGATCAACCCAGCGACGTCGCGGTTGCTCCAGTCACCAAAGCCGACGATCGTGTGACGATCGACACTCTCAGTCAGCTGCAGACACAT
CTTGCACAGCTACTTTTGCATGCTTATAAATCTTCGCAACTTGAGTTTTCTAAATGGATTTAACACAGAGAAAATCAATAAGAGATTCAGTCGCGGGATC
ATAATGTCAACGTACTATTTCATGCGCTCCAACAAGGCCATCTTCTTTGTCGGCATGTTCCGGACTGCCTCCAGAACGTCGTTTTGACTGTGCTTCCAGT
GGCGAATGATCTGATTGCTCTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACGAAAAG
ATCCCTGCAACCGGGATCCAGACCTCAAACCACATCGTAGTCCGCCGGGTTGATGTTTCATGTAGTCGACTTGTACTTGAGTTTGCGAAGTACAACGCTC
ACCGACTTCTCATCTGTCAAGTTCTCGCCGGCAAACTTATGGCTGGCAGTCTCAAACTTATCAATGTTGAAAAGCTCTCGCCATGTTGCGTTGATGCCAG
CATTCCGCTCGGACCCTGCACCGGGAGCCTTTTGGCCCGCGAGTTGTAAGAGCGCTCGAAGCCCCGTTTTGCACATCTTGAAATGACTGCTCACGAACCC
CTTCTTGAATAGGAGAAGACTGAACGCGCGAACCTTCACAAATCCAGGTGTACGCTGATTCAGGCGATTGTGCTCTTCAATGTAGGCGAGAAACGTGTAC
AGCAAAGGTAAGAGTATATGTGGCTGGTGATCGACTTTGCTGTTGGATTGACGTGGGATACGTATACGC