Description :
From Genome Similarity Track
Location :
Scaffold_130:51623- 54384
Transcript NameFunction/comments
Physo_143132hypothetical protein

Sequence
2761 bases(100 bases per row)
GCCCTTGTGCGCAATCTGCATCTTGGTGCTGTCGAACACGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACCGAAAGCAGATTCTTGCTCATGCTT
GGGACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACACCCATGATGGCCGCCTTGT
TGCCGTCGGCCACCGAAAGTTCGCCTTCATTCCGCTCAATCAAATGAGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGACCGC
CCACAACCCGGACACATTCTTGCCCGTCGAAATGCCACACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGTCGACTCATCGAAGTTGACATCG
CGACTGATAACCACCTGCCCCGCCTCGATGTCATAAACTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAGCCCGGCGCGAGCCTTGGGGTCCC
ACTTGCGCCGTCTTTCCTTCGGCGTCAGGATGTACGTCTGGCATCCGAACACACGCATGTGCTTCACACTCGGCTTGGACTTGTAAACGATCTCGAACGG
AGTCTTGTGTTCGATCTTGGGTGATGGCAGACGATTCTTCACGTAGATGGCTGTCATGGCCGCCTCAGCCCAGAAGCTCTTGTCCAGCTTGGCGTGATGC
AGCATGCTGCGGCCAATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCGATGCCTT
CGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCACGGGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCGT
GACGTACATCTTGATGCAGTCCTCGCTCTCCGACTTGGCACGCAGGCAGAATCCCTTCATGCATCCGCTGGCTTCGTCCATGATCAGCAGCAGATACTTG
CTGCCACCCAGTGACTCTTCTTCCATGGGGACGCACACGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGTGACGCTTGTCACGGTTGCTTGGGAACGGCT
TCTGGACCATTTTCCCTTGCTGGCAGCCGCGACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTTGTTGTCGACCATCTT
GCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGTAAGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTGGAGCCAG
TAGAGTCCATCCACGAGGTTTGCCGTCGCCACCACTTGCTTGGAGCCCTTGTGCGCAATCTGCATCTTGGTGCTGTCGAACACGACTTGGAACAGACCAC
TCTTGTTGATCTGTGGCACCGAAAGCAGATTCTTGCTCATGCTTGGGACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAAC
CACTCGTTCCACGATGGTCCCCACACCCATGATGGCCGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCTTCATTCCGCTCAATCAAATGAGCGAACTTG
GCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGACCGCCCACAACCCGGACACATTCTTGCCCGTCGAAATGCCACACTCGGGATCCTCTAGAG
TCGACCTGCAGGCATGCAAGCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGTTGTCCTCTGCGTCGTCGTCG
TCCTCTGCGTCGTCGTCGTCCTCTGCATCCTCGATGTCCTCCAGAGTTTCAGGGGCGACCTCCTCCTCCTCCTCTTCAGAGCTCCCGCTAGAGGCGCTCT
CCTCAGGTTCCTGGGTGGGAGGCTGGTAGTCCGGGTCGTTCTCGATGTCGTCCACCGTGGAATCGGCGTCCTCATCAGGGTACACCATGTGGTCATCGAG
GTTCCCCCAGGGTGGTGGCACATCACCGCGTCGAAGGCACCTGTCCAGACGTTCATCCGCCATTTTGTAATAAGCATCAGGGACGTACTTACTCCAGGGG
GTCTTGTCAAGGTGACGCCAGTACATAATGCCCACGAGCATCTTGATCAGCTGCGGCTGTCGGAAGTGCCCGTGAGCTGCGCGGTCGCTGCCAATCCACT
CCATTCTCCGTCCTCTAACCGAGAATCCTGTCTGTCGGTCATCGCGTCACGCTTTCCGCCCCTACAGCCTAAACCTTTCAATTAGACTACGCTACCGCGG
CCTTATTGCATACATTATTCACTCATCAAGTCGCCTCGCACTGGCTTTTAAACTATTTACGAAATTACAAAACTAGACACAATCACGCTAAAAATCGTAC
TTACGCGGAAATAATCGGACTTTAACGGGTGTGATTATCACATCCCCCATTTTGAAAGTTGGCGCGCGGTGGGCGGACGGACGGAGGCAACGAGCGGGAG
GGCGCGTGGCGTACGGGAGTGAGCAGCGGAGCGCAGCGGCAGCGGACACTGCTACAGTGAGTACATGCATACATCTACATAAATAAACTACTTTACGGTT
TCGGGAGTTCCGCCTGTTGGGATAACTGGTACCTTCAGGGCAGTCGATGGATTACAGTTCG