Description :
From Genome Similarity Track
Location :
Scaffold_835:5162- 8725
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_835-fgenesh-gene-0.1Intraflagellar Transport Protein 140
Pytve_DAOMBR484maker-pve_contig_835-fgenesh-gene-0.0Ankyrin repeat protein

Sequence
3563 bases(100 bases per row)
GCGCGGGCGGATGACGCCGATCGGAGCGAACGCGCTCGCCATCGTCGGCAGCTCGCGGATCGACGGCAGCTTGAAGCCCGTGGCCGCCGGATGGGTCGGC
GACAGCACCGGCAGCGGCTCGGATGCCGCCATCGGCGCCGGAAGCCACAGCGCAGGCACGTGCGACGCCTCCAGTACGGCGTCAGCCTTGGCCGCCGCCT
CGGGGCGAGGCAGGATCGGCTTGCACTTGTCGCTCGAGATCCAGTACGCCTGAGCAGTCTGCGTCGCCGCCGCAGCAGCCGTCCGCTTGCNNNNNNNNNN
NNNNNNNNNNNNNNNGTCTGCGCCGTCCGCCAGCGACGACCCGGCCTTGCGCTTCCGCGACTTCTTGCTCTGGCGCTTCACCAGCGCCATGTCGTCGTAC
TTGTCGCGCGTAAAGTGCTCGCGGCTGTACGTCGGCAGCTGCGACCGCGCCTTGCTCCACTTGCGGAAGCCAAAGTAGTTCAGCTGGCGCTGGAAGCTCG
CAAAGTTCTTGTTCTTAAAGTACCGCGGCAGGATCTGGTGCGTCAGCGCGTCCTTGTCCAGGATCTCGAACGCGAGGCCGTCGCTCGTCCAGCGGATCAC
GCGCGGGTTCTCGCGGCGCAGCATCTGGTGCAGGTGCAGCAGGAACGGCGCCACCCAGCCGCGCTTCGCCGCCTCGGTCGCGGCCCCCGACGACGCGCTC
TCCACGCTCGAGTAGCTGGCGGTCGACGTCGCCGGCGACGGCGGACACTCGGGCTCGACGGGCGACGGCGCCTCGGCCGCGGGGCTCAGCATGTCCAACA
CGTTCATCGCTTTGATTCGCAAGCTGGTCACCTCGACGATGCAAATTCGGGAATGGGCGAGGCGAGGCAAAGGGTAAGGAATAAAAAAGCGCGTGTCTGC
GAGGGAGACAAGGGTGGCTGCCCTCACTCGGAGATTCCTCCGCGGCGGAAAAAGAAAAACTATGAAGATTCACTATGTGGAGCAAATCGCAGTCGCCCTC
GCCAGCGCAGATTCGGCGGGTCGATCGGTCATAGAGAGATCGTATGAGACGAGGGGAATCGAATCTCGGTGCGCATTCATAGGGTTGTGGACGCTGGAGA
TTCTGTCCACGTCAGCCAATCAGCGCGCGGGAAACGAAGGCATCGCAACTGTCTCGTCCGCACACCAACACCACAAAAAAGAACCTTGCGACCACCCTTT
AGAATTCAATGCACTCACGGGGATGCGCACCACATGAACACCTCCAAAACTTATACCTGGCGCGGGTGATCTTGCAGTTTCTATACCAGTCGAATCTCCG
CCACCAATCGCAAGATTCGGAATCCTCCGTGGACTTTTACTTCTTTCGCTCGTGAACGGGTGCACCAGAGTGTTGGTCGCCGTCTGTACGTCAGGTTGAA
GCCCCGAGATTCGCGGCCACCCAGCAAGATGCGGACCCCCTTCGTGCTCGGTAAGGCGCCGCGCTGGTCGGACGAACGCTGGTCGGACGAACGCCGGTCG
CTCCGCATCTCCTTGCTGCACACCCTTCCACCGACCGCCTTTGCGTCGCAGTCGCTTCCGTCAGCTGGCGCTGACGCCAGTGCGTGTGCTGGCTGCAATG
GGCAGGGAATCTCGCTAGCGCCACGGCCGTGCTGCTGCTGCTGGCCGCGAATTCCGGCTCGCACTGGGCGTACGACGCCGCCAACTCGGTGAACATTGGG
CTCTGGCGACTAGCGGTGGGCTGAGCTGCTCTGGCTTTGCGCGTATTGGGATCAGATTCGTGGCTGACCCAGCGGGTTGGCGAAGGGTAATGGAGTGCAA
GCAAAGCTCGTCAGCGCCGGCCTAACCGTCGATAGCGCACAGTCATCGGCAGTAGAAGCGCGGTTCGCGCTGTACAGCAACTATTGGTATGCATTGGTGT
CAAAGTGGCGGTGATACGAGCAACCGTTTGACAGTGTGTGGTTGGTGGGGACATGCAGCTCGCTGTCGACCGATTCGGAGAAGGATCCATGGTGCCAAGG
CAAGGCGACCGCGACACGAGCTCTAGTGGTGATCGCGCTGTTGGTGTCCATCGCGAGCCTCGTGTTTAGCAGCATGGCGACGCTCGGCGTAAAAACTCCG
ACTTGGGATGGCGAGGGTCGCGAGACGACGCTCGTCAATCCCCTGCTCTGCTCGTTCTGCTCGCTGCTCGCGCTGCTGCTGGCCGTGATTACGTGGTACC
AAATGGTAGTCGAATACGACAAATTGTGTCAGTCGACCATGGCGATCGTCACGTTCACATGCATCTCCACGGGGTCTACTTATGCGGTTGCCATCGCTGC
GATCCCTTTTGTGGCATCGACGTATTGGCTCTGGCGACTCGCATACTCCTACCAAGTGCGTGACAGCATGCGTAGAGTTCGTTGCGTTGTATTGCGCTAA
TGATGCTCGTCGACTTGGAAGGAAGCAAAGAAGAGCAGCGAAATCGCCAACGTGTTCACATTAGCGGCCAAGACAGGTAAGCGAGCGGTTCTTGTAGATC
ACCTATACACACTCCACTCGAGATTCATGGGAGCATGTCGCCACAGATAACGTCGACAACATTCTGTCTGCGATTGCCAACAAGATCGACATTGACGCGC
TCGGCTCGGACGGACGCAACGCTCTGCACTGGGCGTGTACCTTGAACCGAACCAGCATCTGCCACGTTCTCCTCAAGAAAGGAGCCAACCTCAGCATTAA
GGACGTACGCAAAGTGATATACATCCAGAGCTTTTGGGTTGGAACCATTCACTTAGCTTGACTGCAGCAAGACGGGTGGACGCCGCTGCACTGGGCGAGT
CGCGTTGGTAGCCTCGACATTGTGCGGCTGCTCGCCAAGCACGGCGCCGACGTCAACATCAAAGACCGCTGGGGCACCACGCCGCTCATGCTGACGGTCG
TTGGCGAAAACCGCGTGGCAGCCGAGACGTTGATCGAGCTAGGCGCCGACACCAACGCCAAGAATGTGGGTGGCGCGACGCTGTTGTCATCGGCATCGAT
TGTGTTGATTCGCATTGCTACATGCACCGATCTGTGATAGGTCTTCGGACAGACGCCGCTGATGCTGTGTATGGAGGCTGGCGCGCGACTCCACCAGCTC
GGAATGACCTTCATCAATGCCGGCGCCGACCTCTGCCTCCAAGATGTGAGCTATCCGACTTTGCTTGCTATGAGATACTTTTCGAATTCTCAGCGTTCGA
TTTCGAGTGCAGGCACAAGGAATGACCGTGGTTCACTATGCAGCCACGTACGGCAACGCCAACCTTCTCATGAACGTCCTGCAGCAGTGCGACTCCGACC
TGGTGGACAAACCCACCAAGGTGCGTTCGCCAGCTCCTGGCTAGCGAAAGTGAACAGAGAATGCTCACCAACTGTCCCTTCTGCAAGTTCGGGGAGACGC
CTTGCCAAGTCGCCAAGCTGCAGAGCCAGACCAGAGTTCTGGAGTTGTTGCTCAGCTGGCAGGCCGGCAACCCTGTGCTGCCTCCGCAGGACGACGACGA
CCAAGACAGCTCGTCCGAAGACACTGACGATGACGAGAGTTCGGACAGTGACAGTAGCGACGA