Description :
From Genome Similarity Track
Location :
Scaffold_538:5162- 7830
Sequence
2668 bases(100 bases per row)
TGATGTCATTACCGACATTAAGTGTGGCGCCTTCAAGGCCGACCGCGCTCGGTGAATTTTCACGTGTCACCCCACACATATCAAAGCAATCACATCCTTG
ATAACTCGGCCCTAGGCCAACCATGCTTTCAGCATGAAGTGACTCGTTATCACAACGAGTAACACTCAACGGAGTATGTGCCGTATCACTAATACTCAAC
GATCTACGCTCGGAATTCATGTTTTCAACATTGGAGTTAGCTAACTCAGACATTCCAATGTCTAGCCCATTGACATCTTCTTTCAAAGGCTCGCGCCAAT
AGTAATTTTGTTGCCTATCAAAGGTGGGTTCATGACTTTCCAAAGCTTCGCTGGGAAAATTGCGCGTAGCGCCTAAGGTCTTCGACCTCCAATCAATCCA
TGGCTCATGTCGTTCAAGCCAAGCCATACCTAGGATGAGACCATATCTCGAGTCCAAATCAAGGACAAGACAGCGTTCAATGCTATCAAAGTCCAAAAAC
TTTATACCTAAGTTCAACGGAGGTACAGTGACACGACTTCCAGTCGCTAAACGAACCGTGATCGAATCACCTCATGCGCTGTAAGCGCTTCAGCATAACA
CTGACTTTCCTCAAGGGAACGACGTCGAGAATAATTGCAAGACGACCCATAATTGATTAAAATCGACCAAGGCTTTTCAAAGCCTTTAACTTTCGCCTCA
GCGACCAACAAGCCAGATTTGTATCCACACTCCATACCAGTAGGTATGGAACTCTTTTTTTGGGGCTAAGCCCTGTTCAACTCTACTTCCTAAAGGTGTT
ACAGAACCTAGTTCTTCCCCAGTAGGGCGCCCCGCGCCTACTGGGTGTCGGCATTTCCCCGTGCAATGCCAGATTTCTGGCTCGGTGTAGAGTGTTGACT
CGTAGCCTGGCGCTGTATACGTAAAGGGCAACCAGGCCGTAAGTGTTTAGTGCTTCCACACGTATAACACCGGCGTACAACACGTTGCTTCTCAGAAGCT
TGAAGTTCAGCTTCACCTTCATCTTCAGCATAGCTGAGGTCCATCGGTTCCGGTCTATTACCGGCTGGAGTACTCGTGTAGTTTACTATCGCAGAACGAG
AGTTGTACCCATTCCAGCCAAGTCTGGCCGACCTGAAATTATGCTCAGCATTAAGAGCAATGCTCACAGCATCTTCAAATGTAGAGGGGTGAACCCGAAA
GACTTCGGTTCTGGAAATGCCAGTACGGAGACCCTGCATGAATATAGTCACATGGACTGCCTCAGGCAGAGGGTCAGACTATATAGCAGCCACGAGAGTT
CTCATCTCTTGGACATAGTCCGTTAACTCATTCTTACCCTGACGGGTTGATAAAAAGCGTGAACGAACGCAATAAGCCTGGTTAGGTGGTGAAAACACCT
GTACCAATTGTGACTGAAGCGACTCCCATGTGGGAAACGCTAAGTCGACCGACGTGCTACACGTCAAGGCCCATTTTCTAGCTCTTCCATCGAGCTTTGA
GATAGCCAGCGAGATCTGTTGATGGTCAAGCTTGATCAGGCCTGATCTCTTGACCCTCTCAATCTCACGGATCCAGAGGATGAGGTGTTCACCCTCCTTT
CCTGAGTAGACTTTAACTTCCACTCTAAGTGGACGAGGCCTAGCCTCTTCGTCTGGAACAGACACATAGCGTGTAGGCATAGCCGACGCCATTTGATCTT
GGACCTGCCCTAGAAGGGACGCTTCATACTGCAAGAAGCCCTCAACACGTGCAGTCAGCACCTCCGGGCCTTGCGATACAAGGCATTCCACATACTCTGG
ACCCAAAGATGGGGTCAGCTTATCAAGCGCGACCTTTTGGGCCTCAGAGAGGGGAGTGGGGTTATCCATCCTCACAGAGGATCAGTCTTTAAAGACTCAG
ACGTAGATTGACTACGAGTGCAACCAAGTGTACCGGAGCTACACAGCTCCTTAAGTCTGAGGAATACTTAGTGGTCAAGAGCGATATTAGCTCTAATGAA
CTAGACTCGATGAGTCAATAAGCGTAAAGCTTAAGGTCCCTGTTCCAGGGGACCGCACGATTCAGTGAATCTACAGCACTTAGTGCTCAAGAGTAGCTAC
CTCAGGGAGATGTTGCTAACTCTTAACGATCAACGATCAGAGACGCCTCGCAAGGCACGTGTCTTAGACAAGATCAAAAGGTGAATTGAACTTTATTTAC
GTTTAACTCTATAGAATATCTTAATCCTAATATTACCTAATCTAGGCACTCATGTCCTAAATTACTATCTTTAATATCTTTCTTATCTTGTGGCTGACAC
CCGTCAGCCCCTATAAACCGATAAGATATTCTATATCTCTTTTAGTGGGATACCATCCCGTGTGTCTAAGACACAGGGTATCGAGTACCCTACGATGTGT
AACCCCTTGACAGATGTGACGGCTCTCTTGGTTTCCTGGCTACTTGTCGGTGACACAATAGCGAACGTGTCCTCCAACTTTTGTGTCGGCCCTCCGGTAC
TCCCGCTTTGCAACCGCTCGGAGTTGCCGCATACCTGTTTCCCGAAGCTCCTCGACACTGCCGTCGTGTAAGGGTGATCCCGTTACATAAAATTGGTACG
AATGCATCAATTTTTGAATATTATCTATTTAGATGATATTCGATCAACACCACTTGCGAAGAAGTGAT