Description :
From Genome Similarity Track
Location :
Scaffold_127:5161- 9501
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_127-snap-gene-0.11Cytochrome b5 reductase with F-box domain
Pytiw_DAOMBR242034maker-piw_contig_127-snap-gene-0.12Novel protein
Pytiw_DAOMBR242034maker-piw_contig_127-snap-gene-0.7Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_127-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
4340 bases(100 bases per row)
TCGCGCGACTTCTTGATCGCGCGCGAGTGGAACTTGAACATCACGTCCGTGAACGCGGTCGCCATGGGCCCGAAGTTGCGCGAGTGTGCAATGCACCACG
AGATGCGCTCCCAGCGCGTGACCACGACCGCCAAGTTGCCGCGTAGCAGCGGCTTGTTCTTCTTGTCCGCAAGACTGCACAGAACATGGTCGTCCACCAT
GAACTCCTTCATGCTCTCTTTGGCCTCACGCGAGTGCTGGAACTGGTCCCAGATCTCGGTCGCGTCCGTGCCCACGACGTCACCGATGACGTGGTACCCT
CCCGGGTGCGAGTGGATGAACGACGTCACGTCGTACACCTGGTTCTCGATCGCCACGCAGAGCTTCTTGTCATGTTGGAGGCCCAGCAGCCGTGCGAGCT
CCACTGCGCGCGAGAGGTGATGCTGGAAGTAGAATTGGCGCCAGCTGTCGAACGGGAAGACAACGTGGAACCGCTCACCGCTCTCCTGGAAGTCGCGCAG
GTACACGCGTTGCCAAAGCGCGTCGGCGTCGTCTCCCGTGGTCGCGTTCCAGTGCCTGTTGAGAACCGGCAGCTGCGAGAGCTCCTGCGGGTCCAAGAAG
AGCAGCAGCTCACTCAGCACTTCCTGCGGCAGCTGGTGGAACGCCCCAGCGGCGCCTTGGTGACTGGAAATCAACGTACTTGCGGCTGACGTCTTGAGGC
TATGGGCATGCTGCTTGCGCTTGTACGTGTGCACGCGCTTCTCCGTCAGCAGCAGCTCACGGACGATTTCGTCGCGCTCTTCATCGTCTTCCTCTTCTTC
AGCGCCCTGCTTGGCCGCCTCCTTGGTCTTGTGGCGCATGAGCCCAAAGAGCCCCATGCACGCGAGGATGCACGTGTACTCGGACGAGCCAAACTGAATC
GAACTGCTGCTCTGGTGACTACTACTGCTGCTGGCATCGGTCTTCTTGGTGAGCTGCCCACCGCCGTGCGTCGCGAACTGGTACACGACGCACGAGAGCG
CCGAGAGGATGAAGAAGTGCGCCAGGCGGTTGCCCTTCTTCACGGTCGGCGGCACGGCCGTCGCCGCCACTGCCTGGTGGTGTGCTGGTGGTGACTTCGG
CTGAGTGCGAGGCGGTGACTGAGGAGACGCTGGTCGTGGAGAAGAAGCCATGGCGTCGGCCGCGCATCGCCTGCTCACGAGCGCGCTCATGTTGAACTGC
TTTCTCTTTTCGAGGTTCGAGGCTTCCAAATGTAAATTATGTTATTCTTTGCGTGTATACAAAAACCACTGATCGTTGATTGGCCTACGAACGACCAAAT
GAACAAAACCACCTATTTTTACGCTGATTGAATGACGCCTGACATAATAAATAACCAAAAACCATACATTTTAACGGACATCTTGGTTCCACTATGTTCC
TGTTCACCACGCGTGGTTTTTGGTGAAAACGAACGAGATCATACTGGATCCAAGATGTCTGTTAAAATACCAATAAATTTCATGGGAGATTGTTGACGCC
CAACTCCTGGATAAAGATATTTAACTCCTGGATAAAGATACTATAATTGTCGCAAATTCGTGCCGCAATCAGTTTTGCGCTATACAAAAAGTGAGATACC
ATCACGTATCAGATAGTTGTGCGAGAAATCACACAAAAACTCACTCAATTGCCTGAATGGGGAACTTCTCACCGTGCCACTCGAAATCTCCAATGACGAC
ACCTCTGTCCCGATCTTGTGTAGCCTGAACGGGCTCGTCGAAGACGTTGATGCTCCTGCCAAACTCGACTGCGAGCTGGGACTTGATGAGCGCAACGCTG
GCTTTGCCTGGCGACGCGTGCTTAGTCTTGAAGTCGTGGTACAACCGGCCAGTAGAGAGCGAGATCTTGAGTGCGTCTGGCTGGAAAGGGGCCGTGAGCT
CGCCGCCGCCGTACACAAAGAGCCACTTGTTGGTCTTCTCGCCCATGTAAAAATCCTCAAACACGAAGGGCCGGTCAGCGCACTTGATGAAATTCATCTC
CTTGCCGCAGGGCGAGCGGAATGGGTACTCTGGGAACTGGAGCTCTTCATCAATTGCTGCTGCTGGGGTCGGGGCGTTTGGGCGGATCTGCGAGAAGAAG
AACCTGAGGAACTTGGCGCTTTTCAGCGACGTCGCGATGTTCTTCGGCCGCGTGTTCTCCAGAAAGAGTCGACCCTGATATTATAAGACAACATCCAGTC
AATTAGGTCCCACAGAGCATGCTATAAGCCAGCAGGAGCGCAGTGAGCTGCTGTCCACAACGTACCTGCAGGTCAATGTAGTAGAAATAGCGCCGCTCCT
GACCGTGACGGTCATAGAACTCTTCGCTGAATGTTTCGTCGTACCGATACATATATAATGGTATAAGTTTCAAGTGAACAGTCCACCTACTAATTGGAGA
AAGCGCCGCACCTTTTGATGTCGCGGAGCTGCTTGAGCTCGAGGTACTTGTCCTCGTCCGCCGCGGCCGAGTGGGAGCGCAGCTGCTGCTTCAGTAGTAG
TCTGCACTGTGCGACAGCTGCTGTTGCCGCTGGCTGACGCCGCCAGAGCGCCGTCACGCGGCCGTATGCCCGCAGACCTGTTGCTGTGCAGATCATGGCT
CCAAAACGAAAAATGAGCGAATCGAATGTCATTAATCGTGTGTCACTAAATACACTAAAGTGAACTGGGCATACGAAGAGACATCCCAAACATGGCTACA
CTCAGCTCACAAGAAGCATGAGCGACTCGGACTGGTCGTCGTCTTCGTACGACAGCGACGATGGCTCTGCTGACGAAGGAGAGGAAGAAAGAGACGAACT
GGGCCACGACGACCAACCCCTCCACGGTGCCGACGCGTCCCTGCAAGCATCGCTGCCTCACAATGACGACCCGCTCACGCCGCCCATGCGCCAGCGAAGA
GCGCGGCGCGTGAGTCGTTTCGCGCCTGGGAAAGCCAACGACTCCATCACCGCGTACTCGGAGGCGCTGCGCACGACCGCGAGCCACCGCGAGAGTATCT
CGACGGGCCCGACGAGCGGTGTGCAGTTCCTGCTGCCCGAGGAGATGCGGCGGCGTCACCGCGACTCGAAGAAGCGCCTCGAGATCGCCGAGAAGACCCA
GCTCCTGCTGTTCAAGTCGCACGAACTTAATGCCGTCGCTGAGGGCATGCCGCTCTGGGTGCACGCGTGCGTGATCCCTCCACGCTGGCGGCAGCAGATC
ATGGCGCACTTGACACCGATCCACGAGCAGATGCAGTTCTGCGAGCGACACCTGTTGCAGGCCTGGAACTTGCTGCTGCCACCGTTCGACAAAGCGAACT
TTGCTGAGTTTGAGGCGCGCTTCAAGCTCTTTGAGAGTGCGATTTTGCTGCTGGAGGCCGCGGTGGTCGATTGCCAGCAGAGGGCGATCGACGGCGAGAA
GGCCGCGGCGAGCGTGTTCATCCAGCTCTGGTATCGCAAGCAGCTCGCCAAGGTACCACAGGACTCAGACTGGCCTATTGCTGCTCGTAGCGCTCACCGA
TTTCTTCTTGTGTGGGCTGGACTGTAGCGTGGATTTTATACCAAGGTGGTGCGCATCAGTCGGCACGCGCGAGGGCTGATCCCAGGCTTGTTTGACTCGA
CACCCGGGCGCTCCAAGCTCCTGCTCGACAACCGAAGGCAACAAGTGACCATGGAGTTCCCCACCTCTTCGTACCAGCCGGCCTTCCGCTAATAATTGAT
GGAGACAACACACAGCGTGAGTGGAAATAGATTATTGGCTACGCTGGCTTCCGATACTACTACTCGTGAGCTATTAAGTTACTACAATCAGAATAGTGAC
GGCCATGCTCGTCGTCGTAGTAATAGAAGCGGAGACAGAGACGGAGACAACGATAGATAAACAGGAGCAGCGAGAGCCACGAGACGTGTTGGAGCTGGTC
GCGCCAGCTTACGGCCAAAGCCACCAGCTGCTCCTCGTAATGCACGTCCTGGTGACCGTGGGCCACCGTTCATCTGCGCACGGACTGGTTCTCGGGCTTC
TCGAAGAGCGTGTCGAACTGGCGCGACTGGTTGATGGGGTTGCGCTTGAGGTTGGCCATGCGGAAGCGGAACTGGCGCCAGGACGCGCCTGGCGCCTCCT
CGTGGTGGATCGTGCGCTCGCGGCGCTCCTTGTCGATATACACATCTGGGTTGAGGAACATGGTGCGGAAGCCGACGGTCACGGCGCCCACGGCGGCGCC
GCTGGCGATGAGCACGATTGGGAACGTGCCCCGGTCGGTCAGCCAGAGCTTGAAGACGTTGATGCCAGAGCGGGTGGCTTTGGCGGCGGCGACCATGGCT
GGTGAGGTGGTTGGTTACTTGGGAGTAAATTGGGGAATGA