Description :
From Genome Similarity Track
Location :
Scaffold_73:51609- 56567
Sequence
4958 bases(100 bases per row)
AAGTAGACGATGCCATTAAGGCTCGCCATATCGACAAGGAGGAAATGCAGGTTACATTTGCCAAATCGAATTTGTCAGGGCGTGCCAGAACTTGGGCCCT
GAAACTATCCAAACGTGTTTGAATCGTTGGCGGATTTTAAGGTTATGCTCAGACAAACGTTTGAGCCGCCAAGAGCTGAGTTCAGGACTCTTACAGATCT
CCTGAAGATAAAACAAGGTAAGCGTGACGTTGACGCTTACGCTCAGCACATTCGTTACCTTGCAAGTTGCATGGTGGCGAATCCTGGAAGTGAATTTGTT
GATCACGATATTCTTACAGGGCCTCATAGATGGTCCCATGAGGAACCACCTATTCCGCATCGAGTTGAAGTCGCTTGAGGAAGCGATCACAACTGCTGTG
CAAGAGGACTTTAGTGTGAGACAGGCTCACACTAGCTTGACCTCGTATCTTCCTTCGAGACGAGTAGAGGCGGGAGGTCCGGAACCAATGGACCTCTGCA
GTGTTGAGAGCAAGATACCTTGTTCTTCAAGCAGTAAGCGATCGCAAAAGTGCAATCGCTGTCAGAAGTTAGGACACTACGCCTACGAGTGTAATGCTTC
ACGCCCAGTGTCTCGAAACACTGAGCAAAGTGATCGACCGTCTGCCAAGGAGGGCAACGGACGCGGGTCCGACGCTGTTGCGAAGTCACAACAGCGTAGC
GGACCGTAAAAAAACGGTCGGGGTCATAAGGGGAAGAGCACTCTACTGATCCAGCAACCTCAATAGAATTTTCGAACCTATTGATGAAAGCTGCTCCAAA
CTCACAATCCTCGTGTGTCTCTGCACTTGGTGATGGGGTACCCCTCATCACCTTGAATTTAGAAGTGACAAAAAATTGTCACTTCGTGTCTTAGTTGACT
GTGGGCGTCGAACAACTTTGTTCTTCGCCAGTCCCTAGAGGATCGTAGGCTCAAGTTTGTTGAGCGCGTTACTCCTCCTACGAGGCTGACGGTGCGCCTC
GCAACAGCCGCATCTATAGCAGTGATGAAACGTCTTGTGAGATTTCACTTCACGTTAGAAGATTTACAGTACAATGATGATTTCACAGTACTTGATTTGG
ATGACAAATTTGATGTCATCCTAGGGTTACCCTGGCTTAGAAGGTACGAGCCAAGGATTAGCTGGCAGCATCGAACCGTGAAGATTCCTGCCACTTGTTC
ATCAGATGGCCATCTGATGAACGTCTTAGAGCGTCCACAAGCGTGTGGATGTACTGAGTGAGTGCGATGGCCTCACTCGCGGTACGGTCGTTAGTACGAC
TGCACAAGATCACAGTGTGACAACAAATCACACTGTTGAGGAAGCTGCCGGCAGCTGTGCGGATGCACAGGCAGCGCCGAAGGTCCACCACTTGAACAAG
TTGAGTGGATCGGGACATAGGTGTACGCCTAGCGGGCGACATACTAGTAACAATAAACTGGTTGCCCACACAGGGCAACACGATGATTCTAGATCGGCTG
GAGAGTCGATAGTAGATGACATAGCGGTGGTAGCACAATCATAGCTAGAAGGCGTCGAGGGAATAAGCAGCCTGTGGAAAAGGGTTCCCAAGAAGAAACT
GAGACATTGAATGTCTTGGTTAATGACGGGTCAAGTGTAGGCACCTATACACTTGATCTGATCGCACCTCCGAAGTCGACTTCGGAGATCACTCAATTGC
CAACGCTAGAACCGAAACGGTTCTTGCGAGATCTGCGTAGTGGCAAGGTCAAGCAGATCTGTGTACTCGTCATGGAGGACGAGTACGTGACTGATATTCG
GTCCGCAGTAGTATTTGCCGAGAACGAACGGGTTTTCAGTAGCTCTTTGATGGACGAAAGTTTCCTAGATGAGAAGACTTGGATTGAGCGATACACGTCT
CAATCTTGGGAGTCGCTTCAGGCAAATCCTTTATATAAGGATTTGAATGAATTCAAGGGCGTGTTCCCTGAATCCGTACCATGCGAATTGCCTAAGGATC
GAGGCACTCGACCTAAAATCGAGCTCAAACCGGGCTCGAAGTACTGTGTCATGAAGCAGTTGCCACTGCCTCGTGAAAAATTACTTGCGATTGACAAGTT
CTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGAAGTCATCTTCCCCTCACAGCTCTCCGACCTTCTGTGTGCGCAAGGCCACAGGAGGATGGCGGATA
GTGCACGCGTTTAACAAGTTGAATGATGCAACGGTACCAGCTCAGACGCCGATACCGAGGAAGGACGTAATCATTGATGGTATGTCAAAGAGTACCATCT
TTTCGTCCATGGATTGATGGATTGCTTCTATCATATCCTAATGCGTAAACGGGACATTTCGTACACGGCAGTAAGCACCCCGAGCGGCATGCTCTGGGAG
TGGCTAGTAATGCTACAAAAGATTAGTAACGCACCTGCCACCTTCAACAGATGTGTTACAAATCCGTTGAGACCGGTGCGAGACTTCGCACCGAGTTACT
TCGACGATATATTCGTCCGTAGCCGGGTTATGGGCGGAATGAAGGACGTAGAGGTTCATAGAACTTTCGTCAGGTTCTTACACTTATGCGCGAGCATAAG
CTGTACGCCAACCTCAGGAAGTGTATATTCGCTGCTAGCGAAATACTATTTCTTAGGTGCATCGTGGGTAAACATGGCGTACGACTTGATACTGAAAAGA
TCAAGGTGATTACCGACTGGCGTGTGCCAGTCGACGTTAAGGGACTAAGAAAGTTACTTGGCCTAGCGGCGTACTTACACAAGTACTCGCGCACCTATGC
TGAGATGACCGTTCATATCTCTCGTCTCTTGAAAAAGAATGAGAAATGGTCATGGAACGCTGATTGTCAGCGTTTCTTCGAAGGTATCAAGCAGATCTTG
ATGCAATCGCCCATCTTGGAGATTGTAGACCAAGACAGACCAATCCATGTGGTCTGTGACGCCAGCGATTTTGCAATCGGCTGCGCGTTAATGCACTACG
ATGCAGACGGCGCAGAGCGTGTCGTCTGTTATCAATTGCGTCAGCTTCAAGCAGCTGAGAGTAATTATCCAGTGCATGATAAGGAACCACTTGCCATGAA
GTATGCAATAGCGAAGTTTCGCGTCTATCTCCTTGGAGATAGGCCGTTCGTAGTCAATACGGACCATGCGTCATTACGCACGGCCGTAAAGAGCCCACAT
CTCTCACAAAGGATGGCGAGATGGATGTCCTTCTTCGCGGAGTACAACTTCTCCGTAGAGTATAAAACCGGACGGCTAAATGTCGTCGAGGACGCGTTGT
CGCGTCAACCCGATTTCGAGTTGGCTGTGCAGTCCAACAGTGAGGTCGATACCACTGTTGCAACACTAGTCACTAGTGTCCCGTCTTCAACATTGCTTGA
CGACATCAAAAAGGCCTACATAGAAGATAAGGCTCTTCTGCGACTAATGGATCATTTGGTTACTCCATCTCGAAAATATCTCAAGGATTTACTGGCCTTG
TATCGATCTTCCGCGGATCAATACACAAGACGCAACGGGTTGCTGTATCATACAGCCGTTGCCGGCGACACACCTTGTGTCGTTGTCCCTACTTATAATG
ATTTGCTTTTACTCATCATGTATGAGTGCTACGATTCACCAACAAGTGGGCATCGTGGGCGTGAGAAGGCTTATCTCACGGTAAGTCGTGACTTTTACTG
GCCCCGCCAGTATCAGTTTGTGCGCAATTACATTCTTGCTTATGAAGTGTGCCAACGGGTGAAGCCCAATCCATCATACCGTGCCCTACTACAGCCTCTA
CCAATCCCGGCTGAGTGCTGGCATTCCGTTTCAATGAATAGACTTTGTCTACAGCTTCCCCGAAGACGCTCACAAGAACAATGGTATTCTTGTGTTTGTA
GATCGATTCAGCAAGATGGTACATCTTGCTGCAGTTAATGATTCAATCTCAGCACATGGTTGAGCCCGTGTCTTCATTGACAAGGTATTACGACTCCACG
GTCTACCCCGTGAACTAGTCTCTGATAGAAATCCTAGGTTCACGGCGACGTTTTGGCAATCCATGATCCGATCCCTCGGAACACGTCTGACTATGTCTAC
TTCTGACCATCCCGAGACTGGTGGTCAGACAGAACGCGTTAACCGCGTCCTCGAAGAGATATTTCGAGGATACGTTCAATCTTTCACAGATTGGAGCGAA
TTTTTTGCTGAGGGTGAAGTTTTAATCAACAATTTCGTGCATGCATCGACAACGCATACACCATTCTTCGTGGATGGCTTACGCCATCCACGCCTACTTA
CCCATTTAGAGTGTGACAATAATTTAAGGGGGGGGATTCGCTCGAGCAAAAACCGTTCTGGCTCTAGCTCATCACGTGTCGAGGTAATTAACGACGCGAA
CGTTGCCGATGTTGATGAAGTGGACATCGAAGAAGATAACCTTATCAATAGTGATGACACTATTGATGACCCAGATAAGGATGACGATGCTGGTGTATTC
AGCATCGCCAATGACTACACCAGCTAGGATGAGAACACCCTCGCTGAAGGAGAGGATGACCTCCTAGCGGTGCGCACAAGGCGCACTGCAACAAACCAAG
GTGATGCAGTAGAAGATTTATTGCTAGCACGAGAAGTAGTGGTCCGTTTCGTGCAAGCCTCCATCGCTAACTCGGTGGACCGGCAGAAATGGAACACTGA
CAAACATGGAAGAGCAAACGTTCTTCTATTTAATGTCGGAGACTTAGTTCTACTGTCTACGGTTAATATAACTAAGCACGTAATAACTAATGTGGCTAGT
AGTTTACTACTAATCAAGTACATCGGCCCATTCCGTGTACTACGTCGCAAAGGCAATGCGACCACAATCGAGTTGCCTCGCAGGATGCGTACGCATCCTA
CGTTTTATGTCGGTCGTCTCCGCCCGTACCATCACCACGAGGTCTCTTTCTCGGGCGA