Description :
From Genome Similarity Track
Location :
scaffold_11:51575- 53565
Transcript NameFunction/comments
Pl_112503H/ACA ribonucleoprotein complex non-core subunit NAF1, putative
Pl_112504hypothetical protein PHYSODRAFT_555681

Sequence
1990 bases(100 bases per row)
AACTACATGCGTACTGGTGTTTGTGGTGTGATTTCCGAACTCGTTCTCTTTGAAACCCCTGACTTTTGAAGAGCAGCAGAACTTTGAAAACTCAGACGGA
AGTTGCACTTGTTGTAGGCGCCAAAATCAGGATGACTGCAGTTTGCACACAAGGCCCCGCGTTAGTAAAATCGTATTAAACGTGTATCGTTGAGATGCCT
CACCCCAGCGCATTGGTCTTCAAAATCACCTTCGAGGCTCGATGCGATGAGTCGTATAAAATATCAAGCCCTAGATGCGGGTAGTTGTGAAAATAGTCAC
CAACAAGTCCACCAGCAACAGTAGCACTGTACAGATACAAAAGAAACAGATTGCTGTCACTAGTCAAATCCACCGCCCAAAGAGTATGCTAGGTATAGTG
TACCCGTCGTTAGGATCCTCAGACTTCCGAAAAACAGACACGGGTGCACCCAGCTCACTAATCACTTCCTGTACATCGGATCAGCTTGTCAGAAACCGAT
ATTCAGTTCCTCGAAACCAATGTGTTTGCAGAACCTGAGGAGACCACCCAAGCTGAATACGCTGCTTCCGGCCAGTAAAAATCAGTGATGTCTGCTCTTC
CGCAACTTCGACGTCAATCTCTTCAAAGTAGTGCCTGCTCACAAAGCTCAGTGAGCTCACCAACTTTTCCGCAATTTCATCCTGCAAACTTTACTTTTTG
GTAGGCATTGGAAGTCGAGGAGATCGATAATCTTCCCCGACGAAGACCATGAACCCCGTCGCTGCTGGAGTAGCGCCATTCTACAGCGTTACACCAACGT
TTATTAGTTTCAAAGTCTCGAGTTGCTTGACAGTGAATAGCGCACATACCGGAAATTCCATGGGCAAGTCCGTGCCATTCTGATACAAATTGCGGTACTC
AGCTGGGATCGGGAACTTGATGCAGCCTCCTTCATAGCCTAATACATAGCTCTACCAAGTATACATGTTATTAGATAGTTCACAGCACCAGGGGCAAAAA
GTTGTGGAATTAACCTGTTCAGTCGCATCGTAGTGACCAGGAAACGTCGGACCGAATAGCTGTTGCATTGCATCCATCACATGTTAATGTGATAATTTGC
ATAACACCATGCAGCAATTTTGTGCGTACGTTGTAGACGGACATGAAGGTGGCGGAAATGTCGCCGCCAAAGATCACGACGCGTCCGAATTTCAGCGCCA
CGCGATTCACGTCATAGAACTCGATAGCCTTTAACGTTTGCTGGATAGAATCGAAGTGCAACTGGAGAGGTGCAGACCATGACAAATATGTCAGAGATGT
TATAATTCGTAGAGATTTAAAAGCACGTTCTCACTTTAAGCCCGTCTTCGGCGGAATCCACAATGACATCGCGCTTGTAGGGCTCCACGGCGTTGTAGGA
GATTTCGAACGGCCGGACAGGCAGGCGGCTCTTGAGTGCGTGCAGCACCTCGGCGATACTCGCGCCGAGGCGGAAAGGGCCTACGCCCACACCCAACTCG
ATGCGCCACACCTCACGGATCATATTAGCAATCGGAAGAAGGTTTTGTACCGAGAATTTGGTACCCCGAATAAAAAGCGAGATAAAAAGCGCTTTTTAAT
GCCGGATCTGTATGATGTGCAGCTTTTTCAAATGATTTTCGGACTGAGTTTTTATACAGGAGGACAACTTGAACGTCACACCCTTATTAGTACAATTAGG
AATGTGTATGAGTCCAGGATAGCAAGAACATATATCTACCAATATTCATATCTATTGTAAAACTCTAACTGTTGGCCCTACTTTTCGTCCTAGATTTCAG
GGTCCTGACTAGGGGGATCCAACCATCGCGACCAGGCCAAGCATTCTGATTACTCTCAGACTGTCTGCTACCAGATAGCCTGGGAGCAATCAGAATGCTT
GGACTAGGTCGATCAATTTTGTCACCAAAATGGAGTTTACCCCTTCGTTGACTTTGTTGAAATTGTTTATTTAACGTTGATTTACATGTA